|
|
eprimer3 |
The Whitehead program must be set up and on the path in order for eprimer3 to find and run it.
Primer3 picks primers for PCR reactions, considering as criteria:
All of these criteria are user-specifiable as constraints.
eprimer3 can also pick hybridisation oligos that are internal to the product.
Techniques for avoiding problems include a thorough understanding of possible vector contaminants and cloning artifacts coupled with database searches using blast, fasta, or other similarity searching program to screen for vector contaminants and possible repeats. Repbase (J. Jurka, A.F.A. Smit, C. Pethiyagoda, and others, 1995-1996, ftp://ncbi.nlm.nih.gov/repository/repbase) is an excellent source of repeat sequences and pointers to the literature. eprimer3 now allows you to screen candidate oligos against a Mispriming Library (or a Mishyb Library in the case of internal oligos).
Sequence quality can be controlled by manual trace viewing and quality clipping or automatic quality clipping programs. Low- quality bases should be changed to N's or can be made part of Excluded Regions. The beginning of a sequencing read is often problematic because of primer peaks, and the end of the read often contains many low-quality or even meaningless called bases. Therefore when picking primers from single-pass sequence it is often best to use the INCLUDED_REGION parameter to ensure that eprimer3 chooses primers in the high quality region of the read.
In addition, eprimer3 takes as input a Sequence Quality list for use with those base calling programs
(e.g. Phred, Bass/Grace, Trout) that output this information.
Try setting the '-explain' option.
% eprimer3 tembl:hsfau1 hsfau.eprimer3 -explain Picks PCR primers and hybridization oligos |
Go to the input files for this example
Go to the output files for this example
Mandatory qualifiers:
[-sequence] seqall The sequence from which to choose primers.
The sequence must be presented 5' to 3'
[-outfile] outfile Output file name
Optional qualifiers (* if not always prompted):
-task menu Tell EPrimer3 what task to perform. Legal
values are 0: 'Pick PCR primers', 1: 'Pick
PCR primers and hybridization probe', 2:
'Pick forward primer only', 3: 'Pick reverse
primer only', 4: 'Pick hybridization probe
only'.
The tasks should be self explanatory.
Briefly, an 'internal oligo' is intended to
be used as a hybridization probe (hyb probe)
to detect the PCR product after
amplification.
-numreturn integer The maximum number of primer pairs to
return. Primer pairs returned are sorted by
their 'quality', in other words by the value
of the objective function (where a lower
number indicates a better primer pair).
Caution: setting this parameter to a large
value will increase running time.
-includedregion range A sub-region of the given sequence in which
to pick primers. For example, often the
first dozen or so bases of a sequence are
vector, and should be excluded from
consideration. The value for this parameter
has the form
(start),(end)
where (start) is the index of the first base
to consider, and (end) is the last in the
primer-picking region.
-target range If one or more Targets is specified then a
legal primer pair must flank at least one of
them. A Target might be a simple sequence
repeat site (for example a CA repeat) or a
single-base-pair polymorphism. The value
should be a space-separated list of
(start),(end)
pairs where (start) is the index of the
first base of a Target, and (end) is the
last
E.g. 50,51 requires primers to surround the
2 bases at positions 50 and 51.
-excludedregion range Primer oligos may not overlap any region
specified in this tag. The associated value
must be a space-separated list of
(start),(end)
pairs where (start) is the index of the
first base of the excluded region, and and
(end) is the last. This tag is useful for
tasks such as excluding regions of low
sequence quality or for excluding regions
containing repetitive elements such as ALUs
or LINEs.
E.g. 401,407 68,70 forbids selection of
primers in the 7 bases starting at 401 and
the 3 bases at 68.
-forwardinput string The sequence of a forward primer to check
and around which to design reverse primers
and optional internal oligos. Must be a
substring of SEQUENCE.
-reverseinput string The sequence of a reverse primer to check
and around which to design forward primers
and optional internal oligos. Must be a
substring of the reverse strand of SEQUENCE.
* -gcclamp integer Require the specified number of consecutive
Gs and Cs at the 3' end of both the forward
and reverse primer. (This parameter has no
effect on the internal oligo if one is
requested.)
* -osize integer Optimum length (in bases) of a primer oligo.
EPrimer3 will attempt to pick primers close
to this length.
* -minsize integer Minimum acceptable length of a primer. Must
be greater than 0 and less than or equal to
MAX-SIZE.
* -maxsize integer Maximum acceptable length (in bases) of a
primer. Currently this parameter cannot be
larger than 35. This limit is governed by
the maximum oligo size for which EPrimer3's
melting-temperature is valid.
* -otm float Optimum melting temperature(Celsius) for a
primer oligo. EPrimer3 will try to pick
primers with melting temperatures are close
to this temperature. The oligo melting
temperature formula in EPrimer3 is that
given in Rychlik, Spencer and Rhoads,
Nucleic Acids Research, vol 18, num 12, pp
6409-6412 and Breslauer, Frank, Bloeker and
Marky, Proc. Natl. Acad. Sci. USA, vol 83,
pp 3746-3750. Please refer to the former
paper for background discussion.
* -mintm float Minimum acceptable melting
temperature(Celsius) for a primer oligo.
* -maxtm float Maximum acceptable melting
temperature(Celsius) for a primer oligo.
* -maxdifftm float Maximum acceptable (unsigned) difference
between the melting temperatures of the
forward and reverse primers.
* -ogcpercent float Primer optimum GC percent.
* -mingc float Minimum allowable percentage of Gs and Cs in
any primer.
* -maxgc float Maximum allowable percentage of Gs and Cs in
any primer generated by Primer.
* -saltconc float The millimolar concentration of salt
(usually KCl) in the PCR. EPrimer3 uses this
argument to calculate oligo melting
temperatures.
* -dnaconc float The nanomolar concentration of annealing
oligos in the PCR. EPrimer3 uses this
argument to calculate oligo melting
temperatures. The default (50nM) works well
with the standard protocol used at the
Whitehead/MIT Center for Genome
Research--0.5 microliters of 20 micromolar
concentration for each primer oligo in a 20
microliter reaction with 10 nanograms
template, 0.025 units/microliter Taq
polymerase in 0.1 mM each dNTP, 1.5mM MgCl2,
50mM KCl, 10mM Tris-HCL (pH 9.3) using 35
cycles with an annealing temperature of 56
degrees Celsius. This parameter corresponds
to 'c' in Rychlik, Spencer and Rhoads'
equation (ii) (Nucleic Acids Research, vol
18, num 12) where a suitable value (for a
lower initial concentration of template) is
'empirically determined'. The value of this
parameter is less than the actual
concentration of oligos in the reaction
because it is the concentration of annealing
oligos, which in turn depends on the amount
of template (including PCR product) in a
given cycle. This concentration increases a
great deal during a PCR; fortunately PCR
seems quite robust for a variety of oligo
melting temperatures.
See ADVICE FOR PICKING PRIMERS.
* -maxpolyx integer The maximum allowable length of a
mononucleotide repeat in a primer, for
example AAAAAA.
* -productosize integer The optimum size for the PCR product. 0
indicates that there is no optimum product
size.
* -productsizerange range The associated values specify the lengths of
the product that the user wants the primers
to create, and is a space separated list of
elements of the form
(x)-(y)
where an (x)-(y) pair is a legal range of
lengths for the product. For example, if one
wants PCR products to be between 100 to 150
bases (inclusive) then one would set this
parameter to 100-150. If one desires PCR
products in either the range from 100 to 150
bases or in the range from 200 to 250 bases
then one would set this parameter to
100-150 200-250.
EPrimer3 favors ranges to the left side of
the parameter string. EPrimer3 will return
legal primers pairs in the first range
regardless the value of the objective
function for these pairs. Only if there are
an insufficient number of primers in the
first range will EPrimer3 return primers in
a subsequent range.
* -productotm float The optimum melting temperature for the PCR
product. 0 indicates that there is no
optimum temperature.
* -productmintm float The minimum allowed melting temperature of
the amplicon. Please see the documentation
on the maximum melting temperature of the
product for details.
* -productmaxtm float The maximum allowed melting temperature of
the amplicon. Product Tm is calculated using
the formula from Bolton and McCarthy, PNAS
84:1390 (1962) as presented in Sambrook,
Fritsch and Maniatis, Molecular Cloning, p
11.46 (1989, CSHL Press).
Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) -
600/length
Where [Na+} is the molar sodium
concentration, (%GC) is the percent of Gs
and Cs in the sequence, and length is the
length of the sequence.
A similar formula is used by the prime
primer selection program in GCG
http://www.gcg.com), which instead uses
675.0/length in the last term (after F.
Baldino, Jr, M.-F. Chesselet, and M.E.
Lewis, Methods in Enzymology 168:766 (1989)
eqn (1) on page 766 without the mismatch and
formamide terms). The formulas here and in
Baldino et al. assume Na+ rather than K+.
According to J.G. Wetmur, Critical Reviews
in BioChem. and Mol. Bio. 26:227 (1991) 50
mM K+ should be equivalent in these formulae
to .2 M Na+. EPrimer3 uses the same salt
concentration value for calculating both the
primer melting temperature and the oligo
melting temperature. If you are planning to
use the PCR product for hybridization later
this behavior will not give you the Tm under
hybridization conditions.
* -oligoexcludedregion range Middle oligos may not overlap any region
specified by this tag. The associated value
must be a space-separated list of
(start),(end)
pairs, where (start) is the index of the
first base of an excluded region, and (end)
is the last. Often one would make Target
regions excluded regions for internal
oligos.
* -oligoinput string The sequence of an internal oligo to check
and around which to design forward and
reverse primers. Must be a substring of
SEQUENCE.
* -oligoosize integer Optimum length (in bases) of an internal
oligo. EPrimer3 will attempt to pick primers
close to this length.
* -oligominsize integer Minimum acceptable length of an internal
oligo. Must be greater than 0 and less than
or equal to INTERNAL-OLIGO-MAX-SIZE.
* -oligomaxsize integer Maximum acceptable length (in bases) of an
internal oligo. Currently this parameter
cannot be larger than 35. This limit is
governed by maximum oligo size for which
EPrimer3's melting-temperature is valid.
* -oligootm float Optimum melting temperature (Celsius) for an
internal oligo. EPrimer3 will try to pick
oligos with melting temperatures that are
close to this temperature. The oligo melting
temperature formula in EPrimer3 is that
given in Rychlik, Spencer and Rhoads,
Nucleic Acids Research, vol 18, num 12, pp
6409-6412 and Breslauer, Frank, Bloeker and
Marky, Proc. Natl. Acad. Sci. USA, vol 83,
pp 3746-3750. Please refer to the former
paper for background discussion.
* -oligomintm float Minimum acceptable melting
temperature(Celsius) for an internal oligo.
* -oligomaxtm float Maximum acceptable melting temperature
(Celsius) for an internal oligo.
* -oligoogcpercent float Internal oligo optimum GC percent.
* -oligomingc float Minimum allowable percentage of Gs and Cs in
an internal oligo.
* -oligomaxgc float Maximum allowable percentage of Gs and Cs in
any internal oligo generated by Primer.
* -oligosaltconc float The millimolar concentration of salt
(usually KCl) in the hybridization. EPrimer3
uses this argument to calculate internal
oligo melting temperatures.
* -oligodnaconc float The nanomolar concentration of annealing
internal oligo in the hybridization.
* -oligoselfany float The maximum allowable local alignment score
when testing an internal oligo for (local)
self-complementarity. Local
self-complementarity is taken to predict the
tendency of oligos to anneal to themselves
The scoring system gives 1.00 for
complementary bases, -0.25 for a match of
any base (or N) with an N, -1.00 for a
mismatch, and -2.00 for a gap. Only
single-base-pair gaps are allowed. For
example, the alignment
5' ATCGNA 3'
|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but
the alignment
5' ATCCGNA 3'
|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative,
and a score of 0.00 indicates that there is
no reasonable local alignment between two
oligos.
* -oligoselfend float The maximum allowable 3'-anchored global
alignment score when testing a single oligo
for self-complementarity.
The scoring system is as for the Maximum
Complementarity argument. In the examples
above the scores are 7.00 and 6.00
respectively. Scores are non-negative, and a
score of 0.00 indicates that there is no
reasonable 3'-anchored global alignment
between two oligos. In order to estimate
3'-anchored global alignments for candidate
oligos, Primer assumes that the sequence
from which to choose oligos is presented 5'
to 3'.
INTERNAL-OLIGO-SELF-END is meaningless when
applied to internal oligos used for
hybridization-based detection, since
primer-dimer will not occur. We recommend
that INTERNAL-OLIGO-SELF-END be set at least
as high as INTERNAL-OLIGO-SELF-ANY.
* -oligomaxpolyx integer The maximum allowable length of an internal
oligo mononucleotide repeat, for example
AAAAAA.
Advanced qualifiers:
-explainflag boolean If this flag is non-0, produce LEFT-EXPLAIN,
RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN
output tags, which are intended to provide
information on the number of oligos and
primer pairs that EPrimer3 examined, and
statistics on the number discarded for
various reasons.
-fileflag boolean If the associated value is non-0, then
EPrimer3 creates two output files for each
input SEQUENCE. File (sequence-id).for lists
all acceptable forward primers for
(sequence-id), and (sequence-id).rev lists
all acceptable reverse primers for
(sequence-id), where (sequence-id) is the
value of the SEQUENCE-ID tag (which must be
supplied). In addition, if the input tag
TASK is 1 or 4, EPrimer3 produces a file
(sequence-id).int, which lists all
acceptable internal oligos.
-firstbaseindex integer This parameter is the index of the first
base in the input sequence. For input and
output using 1-based indexing (such as that
used in GenBank and to which many users are
accustomed) set this parameter to 1. For
input and output using 0-based indexing set
this parameter to 0. (This parameter also
affects the indexes in the contents of the
files produced when the primer file flag is
set.)
-pickanyway boolean If true pick a primer pair even if
LEFT-INPUT, RIGHT-INPUT, or
INTERNAL-OLIGO-INPUT violates specific
constraints.
-mispriminglibrary infile The name of a file containing a nucleotide
sequence library of sequences to avoid
amplifying (for example repetitive
sequences, or possibly the sequences of
genes in a gene family that should not be
amplified.) The file must be in (a slightly
restricted) FASTA format (W. B. Pearson and
D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]);
we briefly discuss the organization of this
file below. If this parameter is specified
then EPrimer3 locally aligns each candidate
primer against each library sequence and
rejects those primers for which the local
alignment score times a specified weight
(see below) exceeds MAX-MISPRIMING. (The
maximum value of the weight is arbitrarily
set to 100.0.)
Each sequence entry in the FASTA-format file
must begin with an 'id line' that starts
with '>'. The contents of the id line is
'slightly restricted' in that EPrimer3
parses everything after any optional
asterisk ('*') as a floating point number to
use as the weight mentioned above. If the
id line contains no asterisk then the weight
defaults to 1.0. The alignment scoring
system used is the same as for calculating
complementarity among oligos (e.g.
SELF-ANY). The remainder of an entry
contains the sequence as lines following the
id line up until a line starting with '>'
or the end of the file. Whitespace and
newlines are ignored. Characters 'A', 'T',
'G', 'C', 'a', 't', 'g', 'c' are retained
and any other character is converted to 'N'
(with the consequence that any IUB / IUPAC
codes for ambiguous bases are converted to
'N'). There are no restrictions on line
length.
An empty value for this parameter indicates
that no repeat library should be used.
-maxmispriming float The maximum allowed weighted similarity with
any sequence in MISPRIMING-LIBRARY.
-pairmaxmispriming float The maximum allowed sum of weighted
similarities of a primer pair (one
similarity for each primer) with any single
sequence in MISPRIMING-LIBRARY.
-numnsaccepted integer Maximum number of unknown bases (N)
allowable in any primer.
-selfany float The maximum allowable local alignment score
when testing a single primer for (local)
self-complementarity and the maximum
allowable local alignment score when testing
for complementarity between forward and
reverse primers. Local self-complementarity
is taken to predict the tendency of primers
to anneal to each other without necessarily
causing self-priming in the PCR. The scoring
system gives 1.00 for complementary bases,
-0.25 for a match of any base (or N) with an
N, -1.00 for a mismatch, and -2.00 for a
gap. Only single-base-pair gaps are allowed.
For example, the alignment
5' ATCGNA 3'
...|| | |
3' TA-CGT 5'
is allowed (and yields a score of 1.75), but
the alignment
5' ATCCGNA 3'
...|| | |
3' TA--CGT 5'
is not considered. Scores are non-negative,
and a score of 0.00 indicates that there is
no reasonable local alignment between two
oligos.
-selfend float The maximum allowable 3'-anchored global
alignment score when testing a single primer
for self-complementarity, and the maximum
allowable 3'-anchored global alignment score
when testing for complementarity between
forward and reverse primers. The 3'-anchored
global alignment score is taken to predict
the likelihood of PCR-priming primer-dimers,
for example
5' ATGCCCTAGCTTCCGGATG 3'
.............||| |||||
..........3' AAGTCCTACATTTAGCCTAGT 5'
or
5' AGGCTATGGGCCTCGCGA 3'
...............||||||
............3' AGCGCTCCGGGTATCGGA 5'
The scoring system is as for the Maximum
Complementarity argument. In the examples
above the scores are 7.00 and 6.00
respectively. Scores are non-negative, and a
score of 0.00 indicates that there is no
reasonable 3'-anchored global alignment
between two oligos. In order to estimate
3'-anchored global alignments for candidate
primers and primer pairs, Primer assumes
that the sequence from which to choose
primers is presented 5' to 3'. It is
nonsensical to provide a larger value for
this parameter than for the Maximum (local)
Complementarity parameter because the score
of a local alignment will always be at least
as great as the score of a global
alignment.
-maxendstability float The maximum stability for the five 3' bases
of a forward or reverse primer. Bigger
numbers mean more stable 3' ends. The value
is the maximum delta G for duplex disruption
for the five 3' bases as calculated using
the nearest neighbor parameters published in
Breslauer, Frank, Bloeker and Marky, Proc.
Natl. Acad. Sci. USA, vol 83, pp 3746-3750.
EPrimer3 uses a completely permissive
default value for backward compatibility
(which we may change in the next release).
Rychlik recommends a maximum value of 9
(Wojciech Rychlik, 'Selection of Primers for
Polymerase Chain Reaction' in BA White,
Ed., 'Methods in Molecular Biology, Vol. 15:
PCR Protocols: Current Methods and
Applications', 1993, pp 31-40, Humana Press,
Totowa NJ).
-oligomishyblibrary infile Similar to MISPRIMING-LIBRARY, except that
the event we seek to avoid is hybridization
of the internal oligo to sequences in this
library rather than priming from them.
The file must be in (a slightly restricted)
FASTA format (W. B. Pearson and D.J. Lipman,
PNAS 85:8 pp 2444-2448 [1988]); we briefly
discuss the organization of this file below.
If this parameter is specified then
EPrimer3 locally aligns each candidate oligo
against each library sequence and rejects
those primers for which the local alignment
score times a specified weight (see below)
exceeds INTERNAL-OLIGO-MAX-MISHYB. (The
maximum value of the weight is arbitrarily
set to 12.0.)
Each sequence entry in the FASTA-format file
must begin with an 'id line' that starts
with '>'. The contents of the id line is
'slightly restricted' in that EPrimer3
parses everything after any optional
asterisk ('*') as a floating point number to
use as the weight mentioned above. If the
id line contains no asterisk then the weight
defaults to 1.0. The alignment scoring
system used is the same as for calculating
complementarity among oligos (e.g.
SELF-ANY). The remainder of an entry
contains the sequence as lines following the
id line up until a line starting with '>'
or the end of the file. Whitespace and
newlines are ignored. Characters 'A', 'T',
'G', 'C', 'a', 't', 'g', 'c' are retained
and any other character is converted to 'N'
(with the consequence that any IUB / IUPAC
codes for ambiguous bases are converted to
'N'). There are no restrictions on line
length.
An empty value for this parameter indicates
that no library should be used.
-oligomaxmishyb float Similar to MAX-MISPRIMING except that this
parameter applies to the similarity of
candidate internal oligos to the library
specified in INTERNAL-OLIGO-MISHYB-LIBRARY.
General qualifiers:
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
|
| Mandatory qualifiers | Allowed values | Default | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| [-sequence] (Parameter 1) |
The sequence from which to choose primers. The sequence must be presented 5' to 3' | Readable sequence(s) | Required | ||||||||||
| [-outfile] (Parameter 2) |
Output file name | Output file | <sequence>.eprimer3 | ||||||||||
| Optional qualifiers | Allowed values | Default | |||||||||||
| -task | Tell EPrimer3 what task to perform. Legal values are 0: 'Pick PCR primers', 1: 'Pick PCR primers and hybridization probe', 2: 'Pick forward primer only', 3: 'Pick reverse primer only', 4: 'Pick hybridization probe only'. The tasks should be self explanatory. Briefly, an 'internal oligo' is intended to be used as a hybridization probe (hyb probe) to detect the PCR product after amplification. |
|
0 | ||||||||||
| -numreturn | The maximum number of primer pairs to return. Primer pairs returned are sorted by their 'quality', in other words by the value of the objective function (where a lower number indicates a better primer pair). Caution: setting this parameter to a large value will increase running time. | Integer 0 or more | 5 | ||||||||||
| -includedregion | A sub-region of the given sequence in which to pick primers. For example, often the first dozen or so bases of a sequence are vector, and should be excluded from consideration. The value for this parameter has the form (start),(end) where (start) is the index of the first base to consider, and (end) is the last in the primer-picking region. | Sequence range | full sequence | ||||||||||
| -target | If one or more Targets is specified then a legal primer pair must flank at least one of them. A Target might be a simple sequence repeat site (for example a CA repeat) or a single-base-pair polymorphism. The value should be a space-separated list of (start),(end) pairs where (start) is the index of the first base of a Target, and (end) is the last E.g. 50,51 requires primers to surround the 2 bases at positions 50 and 51. | Sequence range | full sequence | ||||||||||
| -excludedregion | Primer oligos may not overlap any region specified in this tag. The associated value must be a space-separated list of (start),(end) pairs where (start) is the index of the first base of the excluded region, and and (end) is the last. This tag is useful for tasks such as excluding regions of low sequence quality or for excluding regions containing repetitive elements such as ALUs or LINEs. E.g. 401,407 68,70 forbids selection of primers in the 7 bases starting at 401 and the 3 bases at 68. | Sequence range | full sequence | ||||||||||
| -forwardinput | The sequence of a forward primer to check and around which to design reverse primers and optional internal oligos. Must be a substring of SEQUENCE. | Any string is accepted | An empty string is accepted | ||||||||||
| -reverseinput | The sequence of a reverse primer to check and around which to design forward primers and optional internal oligos. Must be a substring of the reverse strand of SEQUENCE. | Any string is accepted | An empty string is accepted | ||||||||||
| -gcclamp | Require the specified number of consecutive Gs and Cs at the 3' end of both the forward and reverse primer. (This parameter has no effect on the internal oligo if one is requested.) | Integer 0 or more | 0 | ||||||||||
| -osize | Optimum length (in bases) of a primer oligo. EPrimer3 will attempt to pick primers close to this length. | Integer 1 or more | 20 | ||||||||||
| -minsize | Minimum acceptable length of a primer. Must be greater than 0 and less than or equal to MAX-SIZE. | Integer 1 or more | 18 | ||||||||||
| -maxsize | Maximum acceptable length (in bases) of a primer. Currently this parameter cannot be larger than 35. This limit is governed by the maximum oligo size for which EPrimer3's melting-temperature is valid. | Integer up to 35 | 27 | ||||||||||
| -otm | Optimum melting temperature(Celsius) for a primer oligo. EPrimer3 will try to pick primers with melting temperatures are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. | Any numeric value | 60.0 | ||||||||||
| -mintm | Minimum acceptable melting temperature(Celsius) for a primer oligo. | Any numeric value | 57.0 | ||||||||||
| -maxtm | Maximum acceptable melting temperature(Celsius) for a primer oligo. | Any numeric value | 63.0 | ||||||||||
| -maxdifftm | Maximum acceptable (unsigned) difference between the melting temperatures of the forward and reverse primers. | Any numeric value | 100.0 | ||||||||||
| -ogcpercent | Primer optimum GC percent. | Any numeric value | 50.0 | ||||||||||
| -mingc | Minimum allowable percentage of Gs and Cs in any primer. | Any numeric value | 20.0 | ||||||||||
| -maxgc | Maximum allowable percentage of Gs and Cs in any primer generated by Primer. | Any numeric value | 80.0 | ||||||||||
| -saltconc | The millimolar concentration of salt (usually KCl) in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures. | Any numeric value | 50.0 | ||||||||||
| -dnaconc | The nanomolar concentration of annealing oligos in the PCR. EPrimer3 uses this argument to calculate oligo melting temperatures. The default (50nM) works well with the standard protocol used at the Whitehead/MIT Center for Genome Research--0.5 microliters of 20 micromolar concentration for each primer oligo in a 20 microliter reaction with 10 nanograms template, 0.025 units/microliter Taq polymerase in 0.1 mM each dNTP, 1.5mM MgCl2, 50mM KCl, 10mM Tris-HCL (pH 9.3) using 35 cycles with an annealing temperature of 56 degrees Celsius. This parameter corresponds to 'c' in Rychlik, Spencer and Rhoads' equation (ii) (Nucleic Acids Research, vol 18, num 12) where a suitable value (for a lower initial concentration of template) is 'empirically determined'. The value of this parameter is less than the actual concentration of oligos in the reaction because it is the concentration of annealing oligos, which in turn depends on the amount of template (including PCR product) in a given cycle. This concentration increases a great deal during a PCR; fortunately PCR seems quite robust for a variety of oligo melting temperatures. See ADVICE FOR PICKING PRIMERS. | Any numeric value | 50.0 | ||||||||||
| -maxpolyx | The maximum allowable length of a mononucleotide repeat in a primer, for example AAAAAA. | Integer 0 or more | 5 | ||||||||||
| -productosize | The optimum size for the PCR product. 0 indicates that there is no optimum product size. | Integer 0 or more | 200 | ||||||||||
| -productsizerange | The associated values specify the lengths of the product that the user wants the primers to create, and is a space separated list of elements of the form (x)-(y) where an (x)-(y) pair is a legal range of lengths for the product. For example, if one wants PCR products to be between 100 to 150 bases (inclusive) then one would set this parameter to 100-150. If one desires PCR products in either the range from 100 to 150 bases or in the range from 200 to 250 bases then one would set this parameter to 100-150 200-250. EPrimer3 favors ranges to the left side of the parameter string. EPrimer3 will return legal primers pairs in the first range regardless the value of the objective function for these pairs. Only if there are an insufficient number of primers in the first range will EPrimer3 return primers in a subsequent range. | Sequence range | 100-300 | ||||||||||
| -productotm | The optimum melting temperature for the PCR product. 0 indicates that there is no optimum temperature. | Any numeric value | 0.0 | ||||||||||
| -productmintm | The minimum allowed melting temperature of the amplicon. Please see the documentation on the maximum melting temperature of the product for details. | Any numeric value | -1000000.0 | ||||||||||
| -productmaxtm | The maximum allowed melting temperature of the amplicon. Product Tm is calculated using the formula from Bolton and McCarthy, PNAS 84:1390 (1962) as presented in Sambrook, Fritsch and Maniatis, Molecular Cloning, p 11.46 (1989, CSHL Press). Tm = 81.5 + 16.6(log10([Na+])) + .41*(%GC) - 600/length Where [Na+} is the molar sodium concentration, (%GC) is the percent of Gs and Cs in the sequence, and length is the length of the sequence. A similar formula is used by the prime primer selection program in GCG http://www.gcg.com), which instead uses 675.0/length in the last term (after F. Baldino, Jr, M.-F. Chesselet, and M.E. Lewis, Methods in Enzymology 168:766 (1989) eqn (1) on page 766 without the mismatch and formamide terms). The formulas here and in Baldino et al. assume Na+ rather than K+. According to J.G. Wetmur, Critical Reviews in BioChem. and Mol. Bio. 26:227 (1991) 50 mM K+ should be equivalent in these formulae to .2 M Na+. EPrimer3 uses the same salt concentration value for calculating both the primer melting temperature and the oligo melting temperature. If you are planning to use the PCR product for hybridization later this behavior will not give you the Tm under hybridization conditions. | Any numeric value | 1000000.0 | ||||||||||
| -oligoexcludedregion | Middle oligos may not overlap any region specified by this tag. The associated value must be a space-separated list of (start),(end) pairs, where (start) is the index of the first base of an excluded region, and (end) is the last. Often one would make Target regions excluded regions for internal oligos. | Sequence range | full sequence | ||||||||||
| -oligoinput | The sequence of an internal oligo to check and around which to design forward and reverse primers. Must be a substring of SEQUENCE. | Any string is accepted | An empty string is accepted | ||||||||||
| -oligoosize | Optimum length (in bases) of an internal oligo. EPrimer3 will attempt to pick primers close to this length. | Integer 0 or more | 20 | ||||||||||
| -oligominsize | Minimum acceptable length of an internal oligo. Must be greater than 0 and less than or equal to INTERNAL-OLIGO-MAX-SIZE. | Integer 0 or more | 18 | ||||||||||
| -oligomaxsize | Maximum acceptable length (in bases) of an internal oligo. Currently this parameter cannot be larger than 35. This limit is governed by maximum oligo size for which EPrimer3's melting-temperature is valid. | Integer up to 35 | 27 | ||||||||||
| -oligootm | Optimum melting temperature (Celsius) for an internal oligo. EPrimer3 will try to pick oligos with melting temperatures that are close to this temperature. The oligo melting temperature formula in EPrimer3 is that given in Rychlik, Spencer and Rhoads, Nucleic Acids Research, vol 18, num 12, pp 6409-6412 and Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. Please refer to the former paper for background discussion. | Any numeric value | 60.0 | ||||||||||
| -oligomintm | Minimum acceptable melting temperature(Celsius) for an internal oligo. | Any numeric value | 57.0 | ||||||||||
| -oligomaxtm | Maximum acceptable melting temperature (Celsius) for an internal oligo. | Any numeric value | 63.0 | ||||||||||
| -oligoogcpercent | Internal oligo optimum GC percent. | Any numeric value | 50.0 | ||||||||||
| -oligomingc | Minimum allowable percentage of Gs and Cs in an internal oligo. | Any numeric value | 20.0 | ||||||||||
| -oligomaxgc | Maximum allowable percentage of Gs and Cs in any internal oligo generated by Primer. | Any numeric value | 80.0 | ||||||||||
| -oligosaltconc | The millimolar concentration of salt (usually KCl) in the hybridization. EPrimer3 uses this argument to calculate internal oligo melting temperatures. | Any numeric value | 50.0 | ||||||||||
| -oligodnaconc | The nanomolar concentration of annealing internal oligo in the hybridization. | Any numeric value | 50.0 | ||||||||||
| -oligoselfany | The maximum allowable local alignment score when testing an internal oligo for (local) self-complementarity. Local self-complementarity is taken to predict the tendency of oligos to anneal to themselves The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' || | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' || | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. | Number up to 9999.990 | 12.00 | ||||||||||
| -oligoselfend | The maximum allowable 3'-anchored global alignment score when testing a single oligo for self-complementarity. The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate oligos, Primer assumes that the sequence from which to choose oligos is presented 5' to 3'. INTERNAL-OLIGO-SELF-END is meaningless when applied to internal oligos used for hybridization-based detection, since primer-dimer will not occur. We recommend that INTERNAL-OLIGO-SELF-END be set at least as high as INTERNAL-OLIGO-SELF-ANY. | Number up to 9999.990 | 12.00 | ||||||||||
| -oligomaxpolyx | The maximum allowable length of an internal oligo mononucleotide repeat, for example AAAAAA. | Integer 0 or more | 5 | ||||||||||
| Advanced qualifiers | Allowed values | Default | |||||||||||
| -explainflag | If this flag is non-0, produce LEFT-EXPLAIN, RIGHT-EXPLAIN, and INTERNAL-OLIGO-EXPLAIN output tags, which are intended to provide information on the number of oligos and primer pairs that EPrimer3 examined, and statistics on the number discarded for various reasons. | Boolean value Yes/No | No | ||||||||||
| -fileflag | If the associated value is non-0, then EPrimer3 creates two output files for each input SEQUENCE. File (sequence-id).for lists all acceptable forward primers for (sequence-id), and (sequence-id).rev lists all acceptable reverse primers for (sequence-id), where (sequence-id) is the value of the SEQUENCE-ID tag (which must be supplied). In addition, if the input tag TASK is 1 or 4, EPrimer3 produces a file (sequence-id).int, which lists all acceptable internal oligos. | Boolean value Yes/No | No | ||||||||||
| -firstbaseindex | This parameter is the index of the first base in the input sequence. For input and output using 1-based indexing (such as that used in GenBank and to which many users are accustomed) set this parameter to 1. For input and output using 0-based indexing set this parameter to 0. (This parameter also affects the indexes in the contents of the files produced when the primer file flag is set.) | Any integer value | 1 | ||||||||||
| -pickanyway | If true pick a primer pair even if LEFT-INPUT, RIGHT-INPUT, or INTERNAL-OLIGO-INPUT violates specific constraints. | Boolean value Yes/No | No | ||||||||||
| -mispriminglibrary | The name of a file containing a nucleotide sequence library of sequences to avoid amplifying (for example repetitive sequences, or possibly the sequences of genes in a gene family that should not be amplified.) The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then EPrimer3 locally aligns each candidate primer against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds MAX-MISPRIMING. (The maximum value of the weight is arbitrarily set to 100.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that EPrimer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no repeat library should be used. | Input file | Required | ||||||||||
| -maxmispriming | The maximum allowed weighted similarity with any sequence in MISPRIMING-LIBRARY. | Number up to 9999.990 | 12.00 | ||||||||||
| -pairmaxmispriming | The maximum allowed sum of weighted similarities of a primer pair (one similarity for each primer) with any single sequence in MISPRIMING-LIBRARY. | Number up to 9999.990 | 24.00 | ||||||||||
| -numnsaccepted | Maximum number of unknown bases (N) allowable in any primer. | Integer 0 or more | 0 | ||||||||||
| -selfany | The maximum allowable local alignment score when testing a single primer for (local) self-complementarity and the maximum allowable local alignment score when testing for complementarity between forward and reverse primers. Local self-complementarity is taken to predict the tendency of primers to anneal to each other without necessarily causing self-priming in the PCR. The scoring system gives 1.00 for complementary bases, -0.25 for a match of any base (or N) with an N, -1.00 for a mismatch, and -2.00 for a gap. Only single-base-pair gaps are allowed. For example, the alignment 5' ATCGNA 3' ...|| | | 3' TA-CGT 5' is allowed (and yields a score of 1.75), but the alignment 5' ATCCGNA 3' ...|| | | 3' TA--CGT 5' is not considered. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable local alignment between two oligos. | Number from 0.000 to 9999.990 | 8.00 | ||||||||||
| -selfend | The maximum allowable 3'-anchored global alignment score when testing a single primer for self-complementarity, and the maximum allowable 3'-anchored global alignment score when testing for complementarity between forward and reverse primers. The 3'-anchored global alignment score is taken to predict the likelihood of PCR-priming primer-dimers, for example 5' ATGCCCTAGCTTCCGGATG 3' .............||| ||||| ..........3' AAGTCCTACATTTAGCCTAGT 5' or 5' AGGCTATGGGCCTCGCGA 3' ...............|||||| ............3' AGCGCTCCGGGTATCGGA 5' The scoring system is as for the Maximum Complementarity argument. In the examples above the scores are 7.00 and 6.00 respectively. Scores are non-negative, and a score of 0.00 indicates that there is no reasonable 3'-anchored global alignment between two oligos. In order to estimate 3'-anchored global alignments for candidate primers and primer pairs, Primer assumes that the sequence from which to choose primers is presented 5' to 3'. It is nonsensical to provide a larger value for this parameter than for the Maximum (local) Complementarity parameter because the score of a local alignment will always be at least as great as the score of a global alignment. | Number 0.000 or more | 3.00 | ||||||||||
| -maxendstability | The maximum stability for the five 3' bases of a forward or reverse primer. Bigger numbers mean more stable 3' ends. The value is the maximum delta G for duplex disruption for the five 3' bases as calculated using the nearest neighbor parameters published in Breslauer, Frank, Bloeker and Marky, Proc. Natl. Acad. Sci. USA, vol 83, pp 3746-3750. EPrimer3 uses a completely permissive default value for backward compatibility (which we may change in the next release). Rychlik recommends a maximum value of 9 (Wojciech Rychlik, 'Selection of Primers for Polymerase Chain Reaction' in BA White, Ed., 'Methods in Molecular Biology, Vol. 15: PCR Protocols: Current Methods and Applications', 1993, pp 31-40, Humana Press, Totowa NJ). | Number up to 1000.000 | 9.0 | ||||||||||
| -oligomishyblibrary | Similar to MISPRIMING-LIBRARY, except that the event we seek to avoid is hybridization of the internal oligo to sequences in this library rather than priming from them. The file must be in (a slightly restricted) FASTA format (W. B. Pearson and D.J. Lipman, PNAS 85:8 pp 2444-2448 [1988]); we briefly discuss the organization of this file below. If this parameter is specified then EPrimer3 locally aligns each candidate oligo against each library sequence and rejects those primers for which the local alignment score times a specified weight (see below) exceeds INTERNAL-OLIGO-MAX-MISHYB. (The maximum value of the weight is arbitrarily set to 12.0.) Each sequence entry in the FASTA-format file must begin with an 'id line' that starts with '>'. The contents of the id line is 'slightly restricted' in that EPrimer3 parses everything after any optional asterisk ('*') as a floating point number to use as the weight mentioned above. If the id line contains no asterisk then the weight defaults to 1.0. The alignment scoring system used is the same as for calculating complementarity among oligos (e.g. SELF-ANY). The remainder of an entry contains the sequence as lines following the id line up until a line starting with '>' or the end of the file. Whitespace and newlines are ignored. Characters 'A', 'T', 'G', 'C', 'a', 't', 'g', 'c' are retained and any other character is converted to 'N' (with the consequence that any IUB / IUPAC codes for ambiguous bases are converted to 'N'). There are no restrictions on line length. An empty value for this parameter indicates that no library should be used. | Input file | Required | ||||||||||
| -oligomaxmishyb | Similar to MAX-MISPRIMING except that this parameter applies to the similarity of candidate internal oligos to the library specified in INTERNAL-OLIGO-MISHYB-LIBRARY. | Number up to 9999.990 | 12.0 | ||||||||||
ID HSFAU1 standard; DNA; HUM; 2016 BP.
XX
AC X65921; S45242;
XX
SV X65921.1
XX
DT 13-MAY-1992 (Rel. 31, Created)
DT 21-JUL-1993 (Rel. 36, Last updated, Version 5)
XX
DE H.sapiens fau 1 gene
XX
KW fau 1 gene.
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Primates; Catarrhini; Hominidae; Homo.
XX
RN [1]
RP 1-2016
RA Kas K.;
RT ;
RL Submitted (29-APR-1992) to the EMBL/GenBank/DDBJ databases.
RL K. Kas, University of Antwerp, Dept of Biochemistry T3.22,
RL Universiteitsplein 1, 2610 Wilrijk, BELGIUM
XX
RN [2]
RP 1-2016
RX MEDLINE; 92412144.
RA Kas K., Michiels L., Merregaert J.;
RT "Genomic structure and expression of the human fau gene: encoding the
RT ribosomal protein S30 fused to a ubiquitin-like protein.";
RL Biochem. Biophys. Res. Commun. 187:927-933(1992).
XX
DR SWISS-PROT; P35544; UBIM_HUMAN.
DR SWISS-PROT; Q05472; RS30_HUMAN.
XX
FH Key Location/Qualifiers
FH
FT source 1..2016
FT /db_xref="taxon:9606"
FT /organism="Homo sapiens"
FT /clone_lib="CML cosmid"
FT /clone="15.1"
FT mRNA join(408..504,774..856,951..1095,1557..1612,1787..>1912)
FT /gene="fau 1"
FT exon 408..504
FT /number=1
FT intron 505..773
FT /number=1
FT exon 774..856
[Part of this file has been deleted for brevity]
FT RAKRRMQYNRRFVNVVPTFGKKKGPNANS"
FT intron 857..950
FT /number=2
FT exon 951..1095
FT /number=3
FT intron 1096..1556
FT /number=3
FT exon 1557..1612
FT /number=4
FT intron 1613..1786
FT /number=4
FT exon 1787..>1912
FT /number=5
FT polyA_signal 1938..1943
XX
SQ Sequence 2016 BP; 421 A; 562 C; 538 G; 495 T; 0 other;
ctaccatttt ccctctcgat tctatatgta cactcgggac aagttctcct gatcgaaaac 60
ggcaaaacta aggccccaag taggaatgcc ttagttttcg gggttaacaa tgattaacac 120
tgagcctcac acccacgcga tgccctcagc tcctcgctca gcgctctcac caacagccgt 180
agcccgcagc cccgctggac accggttctc catccccgca gcgtagcccg gaacatggta 240
gctgccatct ttacctgcta cgccagcctt ctgtgcgcgc aactgtctgg tcccgccccg 300
tcctgcgcga gctgctgccc aggcaggttc gccggtgcga gcgtaaaggg gcggagctag 360
gactgccttg ggcggtacaa atagcaggga accgcgcggt cgctcagcag tgacgtgaca 420
cgcagcccac ggtctgtact gacgcgccct cgcttcttcc tctttctcga ctccatcttc 480
gcggtagctg ggaccgccgt tcaggtaaga atggggcctt ggctggatcc gaagggcttg 540
tagcaggttg gctgcggggt cagaaggcgc ggggggaacc gaagaacggg gcctgctccg 600
tggccctgct ccagtcccta tccgaactcc ttgggaggca ctggccttcc gcacgtgagc 660
cgccgcgacc accatcccgt cgcgatcgtt tctggaccgc tttccactcc caaatctcct 720
ttatcccaga gcatttcttg gcttctctta caagccgtct tttctttact cagtcgccaa 780
tatgcagctc tttgtccgcg cccaggagct acacaccttc gaggtgaccg gccaggaaac 840
ggtcgcccag atcaaggtaa ggctgcttgg tgcgccctgg gttccatttt cttgtgctct 900
tcactctcgc ggcccgaggg aacgcttacg agccttatct ttccctgtag gctcatgtag 960
cctcactgga gggcattgcc ccggaagatc aagtcgtgct cctggcaggc gcgcccctgg 1020
aggatgaggc cactctgggc cagtgcgggg tggaggccct gactaccctg gaagtagcag 1080
gccgcatgct tggaggtgag tgagagagga atgttctttg aagtaccggt aagcgtctag 1140
tgagtgtggg gtgcatagtc ctgacagctg agtgtcacac ctatggtaat agagtacttc 1200
tcactgtctt cagttcagag tgattcttcc tgtttacatc cctcatgttg aacacagacg 1260
tccatgggag actgagccag agtgtagttg tatttcagtc acatcacgag atcctagtct 1320
ggttatcagc ttccacacta aaaattaggt cagaccaggc cccaaagtgc tctataaatt 1380
agaagctgga agatcctgaa atgaaactta agatttcaag gtcaaatatc tgcaactttg 1440
ttctcattac ctattgggcg cagcttctct ttaaaggctt gaattgagaa aagaggggtt 1500
ctgctgggtg gcaccttctt gctcttacct gctggtgcct tcctttccca ctacaggtaa 1560
agtccatggt tccctggccc gtgctggaaa agtgagaggt cagactccta aggtgagtga 1620
gagtattagt ggtcatggtg ttaggacttt ttttcctttc acagctaaac caagtccctg 1680
ggctcttact cggtttgcct tctccctccc tggagatgag cctgagggaa gggatgctag 1740
gtgtggaaga caggaaccag ggcctgatta accttccctt ctccaggtgg ccaaacagga 1800
gaagaagaag aagaagacag gtcgggctaa gcggcggatg cagtacaacc ggcgctttgt 1860
caacgttgtg cccacctttg gcaagaagaa gggccccaat gccaactctt aagtcttttg 1920
taattctggc tttctctaat aaaaaagcca cttagttcag tcatcgcatt gtttcatctt 1980
tacttgcaag gcctcaggga gaggtgtgct tctcgg 2016
//
|
# EPRIMER3 RESULTS FOR HSFAU1
# FORWARD PRIMER STATISTICS:
# considered 16422
# GC content failed 156
# low tm 3616
# high tm 9306
# high any compl 9
# high end compl 26
# long poly-x seq 45
#high 3' stability 304
# ok 2960
# REVERSE PRIMER STATISTICS:
# considered 16330
# GC content failed 161
# low tm 3580
# high tm 9309
# high any compl 2
# high end compl 9
# long poly-x seq 66
#high 3' stability 301
# ok 2902
# PRIMER PAIR STATISTICS:
# considered 2652
# unacceptable product size 2444
# high any compl 2
# high end compl 20
# ok 186
# Start Len Tm GC% Sequence
1 PRODUCT SIZE: 202
FORWARD PRIMER 801 20 59.72 60.00 CCCAGGAGCTACACACCTTC
REVERSE PRIMER 983 20 59.81 55.00 GGAGCACGACTTGATCTTCC
2 PRODUCT SIZE: 203
FORWARD PRIMER 1810 20 59.43 55.00 GAAGAAGACAGGTCGGGCTA
REVERSE PRIMER 1993 20 59.99 60.00 GAAGCACACCTCTCCCTGAG
3 PRODUCT SIZE: 204
FORWARD PRIMER 1810 20 59.43 55.00 GAAGAAGACAGGTCGGGCTA
REVERSE PRIMER 1994 20 59.99 55.00 AGAAGCACACCTCTCCCTGA
4 PRODUCT SIZE: 196
FORWARD PRIMER 1266 20 59.43 60.00 GGGAGACTGAGCCAGAGTGT
REVERSE PRIMER 1442 20 60.06 50.00 GCGCCCAATAGGTAATGAGA
5 PRODUCT SIZE: 205
FORWARD PRIMER 801 20 59.72 60.00 CCCAGGAGCTACACACCTTC
REVERSE PRIMER 986 20 60.41 55.00 CCAGGAGCACGACTTGATCT
|
If the '-explain' flag has been used, as in the example, then statistics are output describing the number of primers that were considered and rejected for various reasons.
Headers describing the input file name and the names of the output columns are displayed.
The best 5 primer pairs are displayed with the product size.
The reverse sequence is displayed as the reverse complement to the input forward sense sequence.
The 'Start' positions are given counting from the start of the sequence for both the forward and reverse primer (and for the internal oligos).
Note that if you compare the results to the output from the public Primer3 web site you will see a difference in the reverse primer positions - this is because the original Primer3 program reports the reverse primer positions as counted from the 3' end. The convention in EMBOSS is to report both forward and reverse features as counted from the 5' end, so the reverse primer positions are given counted from the 5' start of the sequence.
The version that is run by this program is 3.0.9 currently available from: http://www-genome.wi.mit.edu/ftp/distribution/software/primer3_0_9_test.tar.gz
| Program name | Description |
|---|---|
| primersearch | Searches DNA sequences for matches with primer pairs |
| stssearch | Searches a DNA database for matches with a set of STS primers |
The Whitehead Institute's primer3 program is not part of this program, but it must be set up on your system and on your path.
The Whitehead Institute's primer3 program is:
Copyright (c) 1996,1997,1998
Whitehead Institute for Biomedical Research. All rights reserved.
The Whitehead Institute requests that use of this software be cited in publications as:
Steve Rozen, Helen J. Skaletsky (1996,1997,1998)
Primer3. Code available at
http://www-genome.wi.mit.edu/genome_software/other/primer3.html
Changed name (version 2.3.0) - Gary Williams
When I wrote the EMBOSS wrapper for the Whitehead's primer3 version 3.0.9 program, I called it 'primer3'. This did not conflict with the Whitehead program becuase although the package is called 'primer3' the program itself is called primer3_core.
I wasn't aware that the Whitehead's primer3 version 3.0.6 program was itself called 'primer3'. This caused a name conflict in those sites with version 3.0.6 installed.
To avoid the conflict, the EMBOSS program was renamed 'eprimer3'. eprimer3 was released in version 2.3.0 of EMBOSS
I apologise for any confusion this may have caused.