|
|
maskfeat |
The feature table is then searched for features whose type matches the specified feature type to be masked. By default, the type is 'repeat*' (i.e. any type whose name starts with 'repeat'). You can specify the name of any other type of feature, or features that you wish to mask. If you wish to specify more than one type of feature, separate their names with spaces or commas. The names of the types of feature to be found may be wild-carded with asterisks '*' to find gruops of feature types sharing a common part of their names.
If you are unsure of the names of feature types in use, please consult http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types.
If any features matching the specified names of feature types are found, then those regions of the sequence will be masked out by replacing that part of the sequence by masking characters. The default masking characters are 'X' for a protein sequence and 'N' for a nucleic acid sequence, although you can specify your own masking character, if required.
Mask out a feature whose type is "repeat_region" from position 2331 to 2356:
% maskfeat tembl:ab000360 Mask off features of a sequence. Output sequence [ab000360.fasta]: |
Go to the input files for this example
Go to the output files for this example
Mandatory qualifiers:
[-sequence] seqall Sequence database USA
[-outseq] seqout Output sequence USA
Optional qualifiers:
-type string By default any feature in the feature table
with a type starting 'repeat' is masked. You
can set this to be any feature type you
wish to mask.
See http://www3.ebi.ac.uk/Services/WebFeat/
for a list of the EMBL feature types and see
Appendix A of the Swissprot user manual in
http://www.expasy.ch/txt/userman.txt for a
list of the Swissprot feature types.
The type may be wildcarded by using '*'.
If you wish to mask more than one type,
separate their names with spaces or commas,
eg:
*UTR repeat*
-maskchar string Character to use when masking.
Default is 'X' for protein sequences, 'N'
for nucleic sequences.
Advanced qualifiers: (none)
General qualifiers:
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
|
| Mandatory qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| [-outseq] (Parameter 2) |
Output sequence USA | Writeable sequence | <sequence>.format |
| Optional qualifiers | Allowed values | Default | |
| -type | By default any feature in the feature table with a type starting 'repeat' is masked. You can set this to be any feature type you wish to mask. See http://www3.ebi.ac.uk/Services/WebFeat/ for a list of the EMBL feature types and see Appendix A of the Swissprot user manual in http://www.expasy.ch/txt/userman.txt for a list of the Swissprot feature types. The type may be wildcarded by using '*'. If you wish to mask more than one type, separate their names with spaces or commas, eg: *UTR repeat* | Any string is accepted | repeat* |
| -maskchar | Character to use when masking. Default is 'X' for protein sequences, 'N' for nucleic sequences. | Any string is accepted | 'X' for protein, 'N' for nucleic |
| Advanced qualifiers | Allowed values | Default | |
| (none) | |||
ID AB000360 standard; DNA; HUM; 2582 BP.
XX
AC AB000360;
XX
SV AB000360.1
XX
DT 27-OCT-1997 (Rel. 53, Created)
DT 27-OCT-1997 (Rel. 53, Last updated, Version 1)
XX
DE Homo sapiens PIGC gene, complete cds.
XX
KW glycosylphosphatidylinositol-synthesis gene; PIGC.
XX
OS Homo sapiens (human)
OC Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC Eutheria; Primates; Catarrhini; Hominidae; Homo.
XX
RN [1]
RP 1-2582
RA Hong Y.;
RT ;
RL Submitted (08-JAN-1997) to the EMBL/GenBank/DDBJ databases.
RL Yeongjin Hong, Research Institute for Microbial Diseases, Immunoregulation;
RL 3-1 Yamada-oka, Suita, Osaka 565, Japan
RL (E-mail:kohishi@biken.osaka-u.ac.jp, Tel:81-6-879-8329, Fax:81-6-875-5233)
XX
RN [2]
RA Hong Y., Ohishi K., Inoue N., Endo Y., Fujita T., Takeda J., Kinoshita T.;
RT "Structures and chromosomal localizations of the
RT glycosylphosphatidylinositol synthesis gene PIGC and its pseudogene
RT PIGCP1";
RL Genomics 44:347-349(1997).
XX
DR SWISS-PROT; Q92535; PIGC_HUMAN.
XX
FH Key Location/Qualifiers
FH
FT source 1..2582
FT /chromosome="1"
FT /db_xref="taxon:9606"
FT /sequenced_mol="DNA"
FT /organism="Homo sapiens"
FT /map="1q23-q25"
FT exon 808..2266
FT CDS 1101..1994
FT /codon_start=1
FT /db_xref="SWISS-PROT:Q92535"
FT /transl_table=1
FT /gene="PIGC"
FT /standard_name="glycosylphosphatidylinositol-synthesis
[Part of this file has been deleted for brevity]
FT variation 2259
FT /replace="t"
FT repeat_region 2331..2356
FT /rpt_unit=gt
XX
SQ Sequence 2582 BP; 694 A; 494 C; 581 G; 813 T; 0 other;
ggatccctgc tgcagagggg gtaacggtgt ctggcttgcc aagcaatatt tgttgtggtc 60
tatcatggaa gaaataaagt cgggcaatat gaattttttt tttctcaaat ttgccggatg 120
gctgtggtgt ttctgactct tagttttctc attgtgaaaa aggaatgatt atcttcttcg 180
atcctctcaa gagtttcctt gttttgagta gattgatagc tctttaaagg atgctaagct 240
cagctaatgg aagaagagtc tagtttcttt gaggctttga ttttggttaa actatagagc 300
tcataccttt ctgtatggtg cagcttacta ttgtctttgg attggtaact taaaaaatac 360
aaataacatg cctttgagaa ccaataaaaa ctatggatat tatccctata aatttacaca 420
aatccagata taagcatgca atgtgatata cctaagggat atgtgaacca ctgagttaag 480
aactgcttta gagggagata caatgtgaga cacaggcttt gggataagac tttggtttga 540
atcctggctc tgctctgtta ccttagggca aagttactta agcatcttga atctcagctt 600
ttttaccaaa gcaggactaa tactaactta caaggtggtg aggattaagt gaaagaagat 660
acataaggca cttagcacat agtaggtact caataagcga tagctaacag atgtctatta 720
ttattcaagg aattataatt ttcaaatctg aaatgcagtt ttaatgtccc ataaggtgac 780
taccacatac atttttctca gacttttagt aaactgagtt gatttgactt tatctcagta 840
ctactcttga cctttcacaa ctttcgtagg ttcacagtct ctctttttct aggaacttgg 900
ctgtgttgtc ctgcctcaga gacaaattca tctattgtag gcctagcccc tgcctttgaa 960
aacaaggaaa ggttggtaga acatcaacac agcatggaat ttccagggag gtctcatttc 1020
aaaacttcat aaagaacaag aaccacctgg acttctgtga gggcgatgat taaactggcc 1080
tgagtttgaa tgaaaggata atgtatgctc aacctgtgac taacaccaag gaggtcaagt 1140
ggcagaaggt cttgtatgag cgacagccct ttcctgataa ctatgtggac cggcgattcc 1200
tggaagagct ccggaaaaac atccatgctc ggaaatacca atattgggct gtggtatttg 1260
agtccagtgt ggtgatccag cagctgtgca gtgtttgtgt ttttgtggtt atctggtggt 1320
atatggatga gggtcttctg gccccccatt ggcttttagg gactggcctg gcttcttcac 1380
tgattgggta tgttttgttt gatctcattg atggaggtga agggcggaag aagagtgggc 1440
agacccggtg ggctgacctg aagagtgccc tagtcttcat tactttcact tatgggtttt 1500
caccagtgct gaagaccctt acagagtctg tcagcactga caccatctat gccatgtcag 1560
tcttcatgct gttaggccat ctcatctttt ttgactatgg tgccaatgct gccattgtat 1620
ccagcacact atccttgaac atggccatct ttgcttctgt atgcttggca tcacgtcttc 1680
cccggtccct gcatgccttc atcatggtga catttgccat tcagattttt gccctgtggc 1740
ccatgttgca gaagaaacta aaggcatgta ctccccggag ctatgtgggg gtcacactgc 1800
tttttgcatt ttcagccgtg ggaggcctac tgtccattag tgctgtggga gccgtactct 1860
ttgcccttct gctgatgtct atctcatgtc tgtgttcatt ctacctcatt cgcttgcagc 1920
tttttaaaga aaacattcat gggccttggg atgaagctga aatcaaggaa gacttgtcca 1980
ggttcctcag ttaaattagg acatccatta cattattaaa gcaagctgat agattagcct 2040
cctaactagt atagaactta aagacagagt tccattctgg aagcagcatg tcattgtggt 2100
aagagaatag agatcaaaac caaaaaaaat gaaccaaagg cttgggtggt gagggtgctt 2160
atcctttctg ttattttgta gatgaaaaaa ctttctgggg acctcttgaa ttacatgctg 2220
taacatatga agtgatgtgg tttctattaa aaaaataaca catccatcaa gttgtctcat 2280
gatttttcca taaacaggag gcagacagag gggcatgaag agtgaagtaa gtgtgtgtgt 2340
gtgtgtgtgt gtgtgtaaag tcacttcttt ctaccctttt caatgtgcta atgctctttt 2400
atttatctag ggctcaaatc ttagaacaca gggtgctatg ctcagttttg ttgcccaaga 2460
tcacagaatt ggttacttaa ccttgactca gagtttctac cttgttctta gggaagcata 2520
tcacaactaa ttgcaaagca gagtgtgatg tgtcacaata agcagaatgc tagggggaat 2580
tc 2582
//
|
>AB000360 AB000360.1 Homo sapiens PIGC gene, complete cds. ggatccctgctgcagagggggtaacggtgtctggcttgccaagcaatatttgttgtggtc tatcatggaagaaataaagtcgggcaatatgaattttttttttctcaaatttgccggatg gctgtggtgtttctgactcttagttttctcattgtgaaaaaggaatgattatcttcttcg atcctctcaagagtttccttgttttgagtagattgatagctctttaaaggatgctaagct cagctaatggaagaagagtctagtttctttgaggctttgattttggttaaactatagagc tcatacctttctgtatggtgcagcttactattgtctttggattggtaacttaaaaaatac aaataacatgcctttgagaaccaataaaaactatggatattatccctataaatttacaca aatccagatataagcatgcaatgtgatatacctaagggatatgtgaaccactgagttaag aactgctttagagggagatacaatgtgagacacaggctttgggataagactttggtttga atcctggctctgctctgttaccttagggcaaagttacttaagcatcttgaatctcagctt ttttaccaaagcaggactaatactaacttacaaggtggtgaggattaagtgaaagaagat acataaggcacttagcacatagtaggtactcaataagcgatagctaacagatgtctatta ttattcaaggaattataattttcaaatctgaaatgcagttttaatgtcccataaggtgac taccacatacatttttctcagacttttagtaaactgagttgatttgactttatctcagta ctactcttgacctttcacaactttcgtaggttcacagtctctctttttctaggaacttgg ctgtgttgtcctgcctcagagacaaattcatctattgtaggcctagcccctgcctttgaa aacaaggaaaggttggtagaacatcaacacagcatggaatttccagggaggtctcatttc aaaacttcataaagaacaagaaccacctggacttctgtgagggcgatgattaaactggcc tgagtttgaatgaaaggataatgtatgctcaacctgtgactaacaccaaggaggtcaagt ggcagaaggtcttgtatgagcgacagccctttcctgataactatgtggaccggcgattcc tggaagagctccggaaaaacatccatgctcggaaataccaatattgggctgtggtatttg agtccagtgtggtgatccagcagctgtgcagtgtttgtgtttttgtggttatctggtggt atatggatgagggtcttctggccccccattggcttttagggactggcctggcttcttcac tgattgggtatgttttgtttgatctcattgatggaggtgaagggcggaagaagagtgggc agacccggtgggctgacctgaagagtgccctagtcttcattactttcacttatgggtttt caccagtgctgaagacccttacagagtctgtcagcactgacaccatctatgccatgtcag tcttcatgctgttaggccatctcatcttttttgactatggtgccaatgctgccattgtat ccagcacactatccttgaacatggccatctttgcttctgtatgcttggcatcacgtcttc cccggtccctgcatgccttcatcatggtgacatttgccattcagatttttgccctgtggc ccatgttgcagaagaaactaaaggcatgtactccccggagctatgtgggggtcacactgc tttttgcattttcagccgtgggaggcctactgtccattagtgctgtgggagccgtactct ttgcccttctgctgatgtctatctcatgtctgtgttcattctacctcattcgcttgcagc tttttaaagaaaacattcatgggccttgggatgaagctgaaatcaaggaagacttgtcca ggttcctcagttaaattaggacatccattacattattaaagcaagctgatagattagcct cctaactagtatagaacttaaagacagagttccattctggaagcagcatgtcattgtggt aagagaatagagatcaaaaccaaaaaaaatgaaccaaaggcttgggtggtgagggtgctt atcctttctgttattttgtagatgaaaaaactttctggggacctcttgaattacatgctg taacatatgaagtgatgtggtttctattaaaaaaataacacatccatcaagttgtctcat gatttttccataaacaggaggcagacagaggggcatgaagagtgaagtaaNNNNNNNNNN NNNNNNNNNNNNNNNNaaagtcacttctttctacccttttcaatgtgctaatgctctttt atttatctagggctcaaatcttagaacacagggtgctatgctcagttttgttgcccaaga tcacagaattggttacttaaccttgactcagagtttctaccttgttcttagggaagcata tcacaactaattgcaaagcagagtgtgatgtgtcacaataagcagaatgctagggggaat tc |
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| coderet | Extract CDS, mRNA and translations from feature tables |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Writes a list file of the logical OR of two sets of sequences |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Excludes a set of sequences and writes out the remaining ones |
| nthseq | Writes one sequence from a multiple set of sequences |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| showfeat | Show features of a sequence |
| skipseq | Reads and writes (returns) sequences, skipping the first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| twofeat | Finds neighbouring pairs of features in sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |
maskseq simply masks a user-specified set of regions, without using annotated features.