|
|
nthseq |
This default behaviour can be changed by using the qualifier '-ossingle' which writes many sequences into many files, each containing one sequence.
The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.
If, however you have the situation where you have a file containing multiple sequences and you wish to extract one of them, then this application may be useful.
nthseq allows you to specify the name of the output file, so you may find that it is useful to include this program in scripts where you need to be able to specify the name of the resulting sequence files you create.
This application extracts the indicated sequence from a multiple set of sequences and writes it out.
% nthseq Writes one sequence from a multiple set of sequences Input sequence(s): tembl:eclac* The number of the sequence to output [1]: 2 Output sequence [eclac.fasta]: |
Go to the input files for this example
Go to the output files for this example
Mandatory qualifiers:
[-sequence] seqall Sequence database USA
-number integer The number of the sequence to output
[-outseq] seqout Output sequence USA
Optional qualifiers: (none)
Advanced qualifiers: (none)
General qualifiers:
-help boolean Report command line options. More
information on associated and general
qualifiers can be found with -help -verbose
|
| Mandatory qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) |
Sequence database USA | Readable sequence(s) | Required |
| -number | The number of the sequence to output | Integer 1 or more | 1 |
| [-outseq] (Parameter 2) |
Output sequence USA | Writeable sequence | <sequence>.format |
| Optional qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced qualifiers | Allowed values | Default | |
| (none) | |||
In the example, the second sequence from the input file will be written out to the specified output file.
>ECLACA X51872.1 Escherichia coli lacA gene for thiogalactoside transacetylase gtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgaccaaca tatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcaggcaag ctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgttaatg tatgagtttaatcactcgcatccatcagaagttgaaaaaagagaaagcctgattaaagaa atgtttgccacggtaggggaaaacgcctgggtagaaccgcctgtctatttctcttacggt tccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcgatgac tacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccgttacg ggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccgataacg attggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcaccatcggg gataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacgtcgtg gcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcactattat ttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacgctgcg cttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaagcgca ggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggtgcaaa acgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtccatcag gtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcgatgat aaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcacagagtg atcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacacaccat cgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccaccagttg taacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagcaggcat cagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctgtactg cgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcgtaacc gccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaataccacgcg aaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccaccacca ggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccaggtttcg ctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatcagagcc gcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatcaccgaa gcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaagcagca gcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacagactga tggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgccagcc cgcccatggtaaccaccggcagagcggtcgac |
For example:
#!/usr/local/bin/perl -w
if ($#ARGV !=1) {
die "Usage: scriptname in out\n";
}
$count=1;
@list = `infoseq $ARGV[0] -auto -only -name`;
while ($count <= $#list+1) {
system("nthseq -auto $ARGV[0] -n $count $ARGV[1]-$count.seq");
$count++;
}
| Program name | Description |
|---|---|
| biosed | Replace or delete sequence sections |
| cutseq | Removes a specified section from a sequence |
| degapseq | Removes gap characters from sequences |
| descseq | Alter the name or description of a sequence |
| entret | Reads and writes (returns) flatfile entries |
| extractfeat | Extract features from a sequence |
| extractseq | Extract regions from a sequence |
| listor | Writes a list file of the logical OR of two sets of sequences |
| maskfeat | Mask off features of a sequence |
| maskseq | Mask off regions of a sequence |
| newseq | Type in a short new sequence |
| noreturn | Removes carriage return from ASCII files |
| notseq | Excludes a set of sequences and writes out the remaining ones |
| pasteseq | Insert one sequence into another |
| revseq | Reverse and complement a sequence |
| seqret | Reads and writes (returns) sequences |
| seqretsplit | Reads and writes (returns) sequences in individual files |
| skipseq | Reads and writes (returns) sequences, skipping the first few |
| splitter | Split a sequence into (overlapping) smaller sequences |
| trimest | Trim poly-A tails off EST sequences |
| trimseq | Trim ambiguous bits off the ends of sequences |
| union | Reads sequence fragments and builds one sequence |
| vectorstrip | Strips out DNA between a pair of vector sequences |
| yank | Reads a sequence range, appends the full USA to a list file |
The program seqretsplit will take a file containing many sequences and will output many files, each containing one sequence. However you have no choice over the naming of the files - they are named after the ID name fo the sequence they contain.