FINGERPRINT

[ Program Manual | User's Guide | Data Files | Databases ]

Table of Contents
FUNCTION
DESCRIPTION
EXAMPLE
OUTPUT
INPUT FILES
COMMAND-LINE SUMMARY
LOCAL DATA FILES
PARAMETER REFERENCE

FUNCTION

[ Top | Next ]

Fingerprint identifies the products of T1 ribonuclease digestion.

DESCRIPTION

[ Previous | Top | Next ]

Fingerprint cuts any subrange of a nucleotide sequence at Gs (as if it were digested with T1 ribonuclease) and arranges the fragments in order of their U (or T) content. Within families of U (or T) content, the fragments are arranged by A content and then by C content. Fingerprint shows how the fragments would be labeled if the original molecule had been labeled with any single alpha-(32)P-triphosphate by creating a table of the labeled nucleotides that would be found from an alkaline hydrolysis of each fragment. The labels, after hydrolysis, remain on the 3' side of the nearest neighbor 5' to every nucleotide of the kind labeled.

EXAMPLE

[ Previous | Top | Next ]

To identify the fragments of a fingerprint of zein.seq, do the following:


% fingerprint

 FINGERPRINT of what sequence ?  zein.seq

                  Begin (* 1 *) ?  14
                End (*   614 *) ?  250
               Reverse (* No *) ?

 Would you like identical fragments summed (* Yes *) ?

 What should I call the output file (* zein.fing *) ?

%

OUTPUT

[ Previous | Top | Next ]

Fingerprint leaves an extra blank line between "families" of U content. Here is some of the output file for the example above:


 FINGERPRINT of: zein.seq  check: 9712  from: 14  to: 250

Corn Storage Protein 19.1 cDNA
Pedersen Devereux and Larkins at Purdue.  It was sequenced by
Pedersen and Devereux at Smithies' lab at the University of Wisconsin
and at Larkin's lab at Purdue University,  Spring 1981.
Checked carefully September 17, 1981.

                       September 26, 1998 15:36  ..

                                                 Labelling with

     Seq           Pos        GTP     |     ATP     |     UTP     |     CTP

CUUCCCUUCUUCCCCCAUACCUCUCACCAG
                    26        a       |        u 3c |     a 3u 5c |  g 2a 5u 8c

AAAAUCCAAUUCUUCUACCCUACAG
                    32     g  a       |    4a 2u 2c |    2a 2u 3c |    2a 3u 3c

CCAAAAUAUUUUG       10           u    |    3a  u  c |    2a 3u    |  g        c

UCUUUCUG            14           u    |             |       2u 2c |  g    2u

CCUCAUUAUG          11           u    |        u  c |    2a  u  c |  g     u  c

CAUUUUCCCG          22              c |           c |     a 3u    |  g     u 2c

UACCAAUAAUG          7     g     u    |    2a 2u  c |    2a       |     a     c

CACAAUAUUG           6           u    |     a  u 2c |  g 2a  u    |     a

///////////////////////////////////////////////////////////////////////////////

CG                  20                |             |             |
CG                  27                |             |             |
        Total:                     2c | 2g          |             |

G                    8                |             |             |
G                   13                |             |             |
G                   19                |             |             |
G                   33                |             |             |
G                   35                |             |             |
G                   39                |             |             |
        Total:                        |  g          |  g          | 4g

In the output file, the positions (Pos) indicate the order of T1 ribonuclease fragments in the input sequence. The 5'-terminal fragment is 1 and, in this example, the fragment at the 3' end of the sequence range is 39.

INPUT FILES

[ Previous | Top | Next ]

Fingerprint accepts a single nucleotide sequence as input. If Fingerprint rejects your nucleotide sequence, turn to Appendix VI to see how to change or set the type of a sequence.

COMMAND-LINE SUMMARY

[ Previous | Top | Next ]

All parameters for this program may be added to the command line. Use -CHEck to view the summary below and to specify parameters before the program executes. In the summary below, the capitalized letters in the parameter names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.


Minimal Syntax: % fingerprint [-INfile1=]zein.seq -Default

Prompted Parameters:

-BEGin=14 -END=250          sets the range of interest
-REVerse                    uses the reverse strand
[-OUTfile1=]zein.fing       specifies the output file name

Local Data Files:    None

Optional Parameters:

-NOSUMidentical      suppresses summing statistics for identical fragments

LOCAL DATA FILES

[ Previous | Top | Next ]

None.

PARAMETER REFERENCE

[ Previous | Top | Next ]

You can set the parameters listed below from the command line. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.

-NOSUMidentical

suppresses summing the statistics for identical fragments.

Printed: January 9, 2002 13:45 (1162)

[ Program Manual | User's Guide | Data Files | Databases ]


Technical Support: support-us@accelrys.com
or support-eu@accelrys.com

Copyright (c) 1982-2002 Accelrys Inc. A subsidiary of Pharmacopeia, Inc. All rights reserved.

Licenses and Trademarks Wisconsin Package is a trademark and GCG and the GCG logo are registered trademarks of Accelrys Inc.

All other product names mentioned in this documentation may be trademarks, and if so, are trademarks or registered trademarks of their respective holders and are used in this documentation for identification purposes only.

Accelrys Inc.

www.accelrys.com/bio