[ Program Manual | User's Guide | Data Files | Databases ]
Prime selects oligonucleotide primers for a template DNA sequence. The primers may be useful for the polymerase chain reaction (PCR) or for DNA sequencing. You can allow Prime to choose primers from the whole template or limit the choices to a particular set of primers listed in a file.
The Polymerase Chain Reaction (PCR) process for amplifying nucleic acids is covered by U.S. Patent Nos. 4,683,195 and 4,683,202 owned by Hoffmann La Roche. A license for research may be obtained through the purchase and use of authorized reagents and thermocyclers from Perkin-Elmer Corp., or by otherwise negotiating a license with Perkin-Elmer. No license to use PCR is granted by the purchase or use of the Wisconsin Package(TM).
Prime analyzes a template DNA sequence and chooses primer pairs for the polymerase chain reaction (PCR) and primers for DNA sequencing. For PCR primer pair selection, you can choose a target range of the template sequence to be amplified. For DNA sequencing primers, you can specify positions on the template that must be included in the sequencing.
In selecting appropriate primers, Prime considers a variety of constraints on the primer and amplified product sequences. You either can use the program's default constraint values, ignore all constraints or modify those values to customize the analysis. You can specify upper and lower limits for primer and product melting temperatures and for primer and product GC contents. For primers, you can specify a range of acceptable primer sizes, any required bases at the 3' end of the primer (3' clamp), and a maximum difference in primer melting temperatures for PCR primer pairs. For PCR products, you can specify a range of acceptable product sizes.
For efficient priming, you should avoid primers with extensive self-complementarity in order to minimize primer secondary structure and primer dimer formation. Additionally, in PCR experiments, primer pairs with extensive complementarity between the two primers should be avoided in order to minimize primer dimer formation. Prime uses the annealing test described in the ALGORITHM topic to check individual primers for self-complementarity and to check the two primers in a PCR primer pair for complementarity to each other. Using this same annealing test, Prime optionally can screen against non-specific primer binding on the template sequence and on any repeated sequences you specify.
The terms forward primer and reverse primer are used in the remainder of this document and in the program output. Forward primers are complementary to sequences on the reverse template strand and create copies of the forward strand by primer extension. Conversely, reverse primers are complementary to sequences on the forward template strand and create copies of the reverse strand by primer extension.
Here is a session using Prime to select PCR primers to amplify a 100 to 300 base portion of a human globin DNA sequence.
% prime
Prime of what sequence ? ggamma.seq
Begin (* 1 *) ?
End (* 1700 *) ? 500
Minimum primer length (* 18 *) ?
Maximum primer length (* 22 *) ?
Minimum product length (* 100 *) ?
Maximum product length (* 300 *) ?
What should I call the output file name (* ggamma.prime *) ?
This program can display the primer binding sites graphically.
Do you want to:
A) Plot to a FIGURE file called "prime.figure"
B) Plot graphics on LaserWriter attached to /dev/tty10
C) Suppress the plot
Please choose one (* A *):
Searching for forward primers
.................................
Searching for reverse primers
................................
Selecting primer pairs
.............................................................
.............................................................
........................................
FIGURE instructions are now being written into prime.figure.
////////////////////////////////////////////////////////////////
Output file: ggamma.prime
CPU time: 1.41 seconds
%
Here is some of the output file listing the twenty-five most appropriate PCR primer pairs selected by Prime.
PRIME of: ggamma.seq ck: 3814 from: 1 to: 500 November 16, 2000 10:20
INPUT SUMMARY
-------------
Input sequence: gendocdata:ggamma.seq
Primer constraints:
primer size: 18 - 22
primer 3' clamp: S
primer sequence ambiguity: NOT ALLOWED
primer GC content: 40.0 - 55.0%
primer Tm: 50.0 - 65.0 degrees Celsius
primer self-annealing. . .
3' end: < 8 (weight: 2.0)
total: < 14 (weight: 1.0)
unique primer binding sites: required
primer-template and primer-repeat annealing. . .
3' end: ignored
total: ignored
repeated sequences screened: none specified
Product constraints:
product length: 100 - 300
product GC content: 40.0 - 55.0%
product Tm: 70.0 - 95.0 degrees Celsius
duplicate primer endpoints: NOT ALLOWED
difference in primer Tm: < 2.0 degrees Celsius
primer-primer annealing. . .
3' end: < 8 (weight: 2.0)
total: < 14 (weight: 1.0)
PRIMER SUMMARY
--------------
forward reverse
Number of primers considered: 1403 1403
Number of primers rejected for . . .
primer 3' clamp: 227 225
primer sequence ambiguity: 0 0
primer GC content: 623 631
primer Tm: 170 178
non-unique binding sites: 0 0
primer self-annealing: 56 57
primer-template annealing: 0 0
primer-repeat annealing: 0 0
Number of primers accepted: 327 312
PRODUCT SUMMARY
---------------
Number of products considered: 102024
Number of products rejected for. . .
product length: 76315
product GC content: 1636
product Tm: 0
product position: 0
duplicate primer endpoints: 9001
difference in primer Tm: 5992
primer-primer annealing: 7455
Number of products accepted: 1625
Number of products saved: 25
Maximum overlap between products: 300 bp
THE FOLLOWING PRODUCTS ARE SORTED BY THEIR ANNEALING SCORE
--------------------------------------------------------------------------------
Product: 1
[DNA] = 50.000 nM [salt] = 50.000 mM
PRIMERS
-------
5' 3'
forward primer (19-mer): 13 TCAGCAGTTCCACACACTC 31
reverse primer (20-mer): 161 GTTTCTCCTCCAGCATCTTC 142
forward reverse
primer %GC: 52.6 50.0
primer Tm (degrees Celsius): 51.6 50.1
PRODUCT
-------
product length: 149
product %GC: 51.0
product Tm: 76.3 degrees Celsius
difference in primer Tm: 1.5 degrees Celsius
annealing score: 37
optimal annealing temperature: 53.5 degrees Celsius
--------------------------------------------------------------------------------
Product: 2
[DNA] = 50.000 nM [salt] = 50.000 mM
PRIMERS
-------
5' 3'
forward primer (20-mer): 17 CAGTTCCACACACTCGCTTC 36
reverse primer (20-mer): 144 TTCCACATTCACCTTGCCCC 125
////////////////////////////////////////////////////////////////
The output file begins with a summary listing all of the constraints used by the program to select appropriate primers or PCR primer pairs. Most of these constraints can be modified by adjusting the program parameters. Many of these constraints were described in the DESCRIPTION topic of this document. Several of the constraints, including primer-self annealing, primer-template annealing, primer-primer annealing, and duplicate primer endpoints, are explained more fully in the ALGORITHM and CONSIDERATIONS topics.
Following the input summary, a primer summary lists the number of forward and reverse primers considered by Prime and the number of primers rejected because they failed to meet the various primer constraints. You can use this information to relax the appropriate program constraints if few or no primers are accepted.
If you are selecting PCR primer pairs, the primer summary is followed by a product summary listing the number of PCR products considered by Prime and the number of products rejected because they failed to meet the various product constraints. Again, you can use this information to relax the appropriate program constraints if few or no PCR primer pairs are selected.
Following these summaries is an ordered listing of the most appropriate primers or PCR primer pairs selected by Prime. The list is ordered by total annealing score (see the ALGORITHM topic) so that those primers or PCR primer pairs with the least amount of complementarity to sequences other than the appropriate primer binding sites are listed first. Each output primer or PCR primer pair is designated by a number that corresponds to a line number in the plot of primer sites. While the text output file lists the location of the primer binding site along with each primer sequence, the plot provides a convenient way to review the primer binding sites of many of the selected primers at once.
Prime can create a plot of the primer sites that can help you rapidly review the primer binding sites for the primers selected by the program. The line numbers in the plot correspond to the primer or product numbers in the text output file. Short blue lines extending above the horizontal sequence line indicate the positions of forward primers and short red lines extending below the sequence line indicate the positions of reverse primers.
By default, Prime writes instructions for plotting the primer sites into a figure file named prime.figure. Such files can be plotted on any supported graphics device using the Figure program.
Prime accepts any nucleotide sequence as input and selects appropriate oligonucleotide primers that are complementary to sites on the input template sequence. If Prime rejects your nucleotide sequence, turn to Appendix VI to see how to change or set the type of a sequence.
You optionally can specify one or two input files of primer sequences from which to select appropriate oligonucleotide primers that are complementary to sites on the template sequence with -PRImers or -PRIMERSF and/or -PRIMERSR. The file of primer sequences for Prime is modeled on the enzyme data files for the mapping programs described in Appendix VII. The primer names should not have more than 31 characters. The offset field is ignored by Prime, but the field must have a number in it to make the input primer files compatible with the files that are read by mapping programs. The input primer sequence may contain only valid GCG sequence symbols (see Appendix III of this manual) and the single quotation mark ( ' ) and underscore ( _ ) characters. Single quotation marks and underscores in the sequence patterns are ignored. Prime ignores input primers containing any other characters in the sequence. The overhang field has no significance to Prime and can be omitted. For other GCG mapping programs, if the overhang field is absent or is a non-numeric character, then the bottom strand is not searched.
The exact spacing between each field does not matter, only the order of the fields in the line. Blank lines and lines that start with an exclamation point ("!") are ignored. Here is part of an example file of input primers:
An example file of input primers for the PRIME program. Name Offset Sequence Documentation .. x13598 1 ACCCTTCAGCAGTTCCACAC ! x24332 1 AAGCACCCTTCAGCAGTTCC ! u35982 1 AAGAGAGGTGGAAATGAGG !
The GCG mapping programs Map, MapPlot, and MapSort can be used to mark finds in the context of a DNA restriction map. FindPatterns identifies sequences that contain short patterns like GAATTC or YRYRYRYR. You can define the patterns ambiguously and allow mismatches. You can provide the patterns in a file or simply type them in from the terminal.
You cannot search for primers longer than 100 bases. You cannot specify a maximum product length greater than 10,000 bases. Prime will not read more than 5,000 primers from an input file of primer sequences.
Prime determines primer melting temperatures by a calculation using the nearest-neighbor model of Borer, and thermodynamic parameters for DNA nearest-neighbor interactions and the salt dependence of oligonucleotides determined by SantaLucia (Proc. Natl. Acad. Sci. USA. 95; 1460-1465 (1986)):
T(m)(primer) = delta H / ((delta S' + R x ln(c/4)) - 273.15
where delta H is the enthalpy of helix formation, delta S' is the salt-adjusted entropy of helix formation (including helix initiation), R is the molar gas constant (1.987 cal/degree Celsius/mol), and c is the primer concentration.
In the above equation, the salt-adjusted delta S' is determined from the delta S at 1M salt according to the equation:
delta S' = delta S + (0.368 x (primer_length - 1) x ln[K(+)])
where [K(+)] is the potassium ion concentration.
Prime determines PCR product melting temperatures using the formula of Baldino, et al. (in Methods Enzymol. 168; 761-777 (1989)) as modified slightly by Rychlik, et al. (Nucleic Acids Res. 18; 6409-6412 (1990)).
T(m)(product) = 0.41 x (% G+C) + 16.6 x log[K(+)] - 675 / len + 81.5
where len is the length of the product.
If you are selecting PCR primer pairs, the output includes a proposed annealing temperature for each listed primer pair. The annealing temperature is calculated using the formula of Rychlik, et al. (Nucleic Acids Res. 18; 6409-6412 (1990)).
T(a) = 0.3 x T(m)(primer) + 0.7 x T(m)(product) - 14.9
Prime uses an annealing test described by Hillier and Green (PCR Methods and Applications. 1; 124-128 (1991)), with slight modification, to check individual primers for self-complementarity and to check the two primers in a PCR primer pair for complementarity to each other. For tests of self-complementarity, a primer sequence in the 5' to 3' orientation is compared with the same sequence in the 3' to 5' orientation. For tests of complementarity between two different primers, one of the primer sequences in the 5' to 3' orientation is compared to the other sequence in the 3' to 5' orientation. The sequences are compared in every register of comparison, using a scoring matrix containing values of complementarity for every pair of nucleotide symbols. (See the LOCAL DATA FILES topic for more information on the scoring matrix.) For each register of comparison, the score of each base pair comparison is determined. The scores of contiguous base pairs with positive comparison values are summed. The maximum score of all such contiguous segments, taken over all registers of comparison between the sequences, determines the total primer-primer annealing score. Complementarity at the 3' ends of the primer sequences has a particularly large influence on primer-dimer formation. Therefore, the maximum score of all contiguous segments that include the 3' position of either primer sequence, taken over all registers of comparison, is separately determined as the 3' primer-primer annealing score.
The same annealing test is used to determine complementarity between the primer and any non-specific binding sites on the template sequences. In this case, the primer in the 5' to 3' orientation is compared over all registers of comparison with both strands of the template sequence in the 3' to 5' orientation to determine a total primer-template annealing score. Since complementarity at the 3' end of the primer sequence has a particularly large effect on non-specific primer binding, the 3' primer-template annealing score is also determined. If you screen against non-specific primer binding on any specified repeated sequences, then total primer-repeat and 3' primer-repeat annealing scores, taken over all registers of comparison in all repeated sequences, are also determined.
Total and 3' annealing scores are saved in tests of primer self-complementarity (to check for secondary structure and primer dimer formation) and in tests of complementarity between the two primers in PCR primer pairs (to check for primer dimer formation). Total and 3' annealing scores are also saved when you screen against non-specific primer binding on the template sequence and when you screen against non-specific primer binding on any specified repeated sequences. Primers are rejected that exceed the maximum score you specify for any of these tests. For those primers that are accepted, the program uses the sum of all annealing scores to determine the order of primers or PCR primer pairs in the output list. You can specify weights for each of these scores to adjust their relative contributions in determining the output order. By default, 3' annealing scores have twice the weight of total annealing scores in determining the output order.
The template sequence may contain ambiguous bases, but Prime will not select primers complementary to any ambiguous sites on the template sequence. If you specify an input file of primer sequences from which to select appropriate oligonucleotide primers, Prime will not select any primers in the file that contain ambiguous bases.
By default, primer selects appropriate PCR primer pairs. To search for DNA sequencing primers, you need to use either -FORward or -REVerse.
When several acceptable PCR primer pairs have the same 3' ends for both primers, Prime outputs only the PCR primer pair with the shortest primer sequences. By not allowing duplicate primer endpoints, Prime increases the diversity among the PCR primer pairs in the output list.
Prime only determines melting temperatures for DNA primers. We do not know of any appropriate nearest-neighbor thermodynamic parameters for RNA-DNA hybrids, so we haven't attempted to calculate melting temperatures for RNA primers. While thermodynamic parameters for RNA duplexes involving mismatches have been described, we do not know of any similar results for DNA duplexes. Therefore, we have not attempted to calculate melting temperatures or other thermodynamic properties for DNA duplexes involving mismatches.
Prime does not currently consider formamide concentration in determining primer melting temperatures.
If Prime fails to select any appropriate primers or PCR primer pairs, review the program summary displayed both on the terminal screen and in the output file. This summary lists the number of primers and PCR primer pairs rejected because they failed to meet each program constraint. With this information, you can determine which constraints to relax in subsequent runs of the Prime program.
To avoid reporting trivially different PCR primer pairs in the output list, use -MAXOverlap to select sets of primer pairs whose PCR products have limited overlap with each other.
The Wisconsin Package must be configured for graphics before you run any program with graphics output! If the % setplot command is available in your installation, this is the easiest way to establish your graphics configuration, but you can also use commands like % postscript that correspond to the graphics languages the Wisconsin Package supports. See Chapter 5, Using Graphics in the User's Guide for more information about configuring your process for graphics.
If you need to stop this program, use <Ctrl>C to reset your terminal and session as gracefully as possible. Searches and comparisons write out the results from the part of the search that is complete when you use <Ctrl>C. The graphics device should stop plotting the current page and start plotting the next page. If the current page is the last page, plotters should put the pen away and graphic terminals should return to interactive mode.
All parameters for this program may be added to the command line. Use -CHEck to view the summary below and to specify parameters before the program executes. In the summary below, the capitalized letters in the parameter names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
Minimal Syntax: % prime [-INfile=]ggamma.seq -Default
Prompted Parameters:
-BEGin1=1 -END1=1700 sets the range of interest
-MINPRImer=18 sets the minimum primer length
-MAXPRImer=22 sets the maximum primer length
-MINPROduct=100 sets the minimum PCR product length
-MAXPROduct=300 sets the maximum PCR product length
[-OUTfile1=]ggamma.prime names the output file
Local Data Files:
-DATa1=prime.cmp assigns scoring matrix for annealing tests
-DATa2=dnastack.dh assigns enthalpies for DNA melting temperature
determination
-DATa3=dnastack.ds assigns entropies for DNA melting temperature
determination
Optional Parameters:
-LIStsize=25 sets the maximum number of output primers or PCR
products shown. The default value is changed to
100 if option -RELAx is set.
-BEGin2=500 -END2=750 sets the target range for PCR amplification
-INClude=60.0 sets the minimum % of specified PCR target range
to be included in PCR products (100% is default)
-MAXOverlap=300 specifies maximum overlap among different PCR products
-FORward selects forward primers, only
-REVerse selects reverse primers, only
-NOPROducts suppresses selection of PCR products
-NOUNIque permits duplicate primer binding sites on template
-PRImers=myfile.dat assigns input file of foward and reverse primers to
consider.
-PRIMERSF=myfileF.dat assigns input file of forward primers to consider.
This option can be used in combination with option
-PRIMERSR, but not in combination with option
-PRImers.
-PRIMERSR=myfileR.dat assigns input file of reverse primers to consider.
This option can be used in combination with option
-PRIMERSF, but not in combination with option
-PRImers.
-REPeats=@mylist.list assigns repeated sequences to check for false priming
-DNAconcentration=50.0 sets the primer DNA concentration (nM)
-SALtconcentration=50.0 sets the salt concentration (mM)
-CLAmp=s specifies primer 3' clamp (using IUB ambiguity codes)
-GCMINPRImer=40.0 sets the minimum primer % G+C
-GCMAXPRImer=55.0 sets the maximum primer % G+C
-TMMINPRImer=50.0 sets the minimum primer melting temperature (Celsius)
-TMMAXPRImer=65.0 sets the maximum primer melting temperature (Celsius)
-ENDANNEALPrimer=8.0 sets the maximum primer-primer 3' annealing score
-ENDWGTPrimer=2.0 sets the relative weight of primer-primer 3'
annealing score
-ALLANNEALPrimer=14.0 sets the maximum primer-primer annealing score
-ALLWGTPrimer=1.0 sets the relative weight of primer-primer annealing
score
-GCMINPROduct=40.0 sets the minimum product % G+C
-GCMAXPROduct=55.0 sets the maximum product % G+C
-TMMINPROduct=70.0 sets the minimum product melting temperature (Celsius)
-TMMAXPROduct=95.0 sets the maximum product melting temperature (Celsius)
-TMDIFference=2.0 sets the maximum difference between melting
temperature of two primers in PCR
-ENDANNEALTemplate=16.0 sets the maximum primer-template 3' annealing score
(primer-template annealing is ignored by default)
-ENDWGTTemplate=0.5 sets the relative weight of primer-template 3'
annealing score
-ALLANNEALTemplate=28.0 sets the maximum primer-template annealing score
(primer-template annealing is ignored by default)
-ALLWGTTemplate=0.25 sets the relative weight of primer-template
annealing score
-RELAx relaxes most of the constraints set by default
(options MINPRImer through MAXPROduct, CLAmp
through TMMAXPRImer, and GCMINPROduct through
TMMAXPROduct)
-SORtbyta sorts the final output list of products by their
annealing temperature (increasing)
-FOUndprimers=primer.dat creates a pattern data file of found primers
-RSF[=prime.rsf] saves primers as features in the RSF file
-DENsity=1700 sets number of bases per 100 platen units in the plot
-SPAcing=1.6 sets number of platen units per line in the plot
-NOPLOt suppresses plot of primer sites
-NOMONitor suppresses screen trace of program progress
-NOSUMmary suppresses screen summary at the end of the program
-BATch submits program to the batch queue
All GCG graphics programs accept these and other switches. See the Using
Graphics chapter of the USERS GUIDE for descriptions.
-FIGure[=filename] stores plot in a file for later input to FIGURE
-FONT=3 draws all text on the plot using font 3
-COLor=1 draws entire plot with pen in stall 1
-SCAle=1.2 enlarges the plot by 20 percent (zoom in)
-XPAN=10.0 moves plot to the right 10 platen units (pan right)
-YPAN=10.0 moves plot up 10 platen units (pan up)
-PORtrait rotates plot 90 degrees
Prime was written by Irv Edelman.
The files described below supply auxiliary data to this program. The program automatically reads them from a public data directory unless you either 1) have a data file with exactly the same name in your current working directory; or 2) name a file on the command line with an expression like -DATa1=myfile.dat. For more information see Chapter 4, Using Data Files in the User's Guide.
Prime reads a scoring matrix from your local directory or the public database to use in the annealing tests that test for primer secondary structure, primer dimer formation, and false priming sites on the template and repeated sequence. The file prime.cmp assigns G-C, A-T, and G-T base pairs values of 3, 2, and 1, respectively, with all other pairs valued at 0.
Prime reads the files dnastack.ds and dnastack.dh for the DNA stacking entropies and enthalpies, respectively, used to calculate oligonucleotide primer melting temperatures.
You can set the parameters listed below from the command line. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.
All the criteria that are set by default can be individually relaxed by prefixing the parameter name with NO.
specifies the minimum primer length. Use -NOMINPRImer to allow primer length to be as short as 2 bases.
specifies the maximum primer length. Use -NOMAXPRImer to allow primer length to be as long as 100 bases.
specifies the minimum PCR product length (when choosing PCR products). Use -NOMINPROduct to have no lower length limit set.
specifies the maximum PCR product length (when choosing PCR products). Use -NOMAXPROduct to allow the product length to be as long as 10000 bases.
sets the maximum number of primers or PCR primer pairs you want to save in the output file, up to a limit of 2500. The default value is 25 unless -RELAx is on the command line, when the default value becomes 100. If you choose primers from both strands of the template sequence but suppress the selection of PCR products with -NOPROducts, then the maximum number of output primers is saved for each strand of the template sequence. In this case, forward primers are listed before the reverse primers in the output file.
sets the target range of the template sequence to be amplified using PCR. Unless you specify that only a portion of the target range must be amplified with -INClude, the program will choose primer pairs that amplify the entire target range of the template sequence.
If you are not choosing primers for PCR amplification experiments (by specifying -FORward, -REVerse, or -NOPROducts), then you can specify parts of the template sequence that must be included in primer extension experiments (like DNA sequencing) with the appropriate use of -BEGin2 and -END2. If you specify a position with -BEGin2, then all forward primer extensions must include that position. If you specify a position with -END2, then all reverse primer extensions must include that position.
tells the program to choose primer pairs that amplify at least 60% of the target range specified with -BEGin2 and -END2. By default, primer pairs are chosen that amplify the entire specified target range.
sets the maximum length of overlap shared among different PCR products. By default, the maximum overlap is the maximum product length. Reduce this value to avoid seeing trivially different primer pairs in your output.
tells the program to select forward primers only. Forward primers bind to sequences on the reverse template strand and create copies of the forward strand by primer extension. NOTE: This parameter used to be called -FORwardprimers. In this version this previous parameter name is still supported, but that will go away in the next version.
tells the program to select reverse primers only. Reverse primers bind to sequences on the forward template strand and create copies of the reverse strand by primer extension. NOTE: This parameter used to be called -REVerseprimers. In this version this previous parameter name is still supported, but that will go away in the next version.
suppresses the selection of primer pairs for PCR amplification experiments. Both forward and reverse primers are selected, but they are not tested in pair combinations to determine if they meet the PCR product constraints. The best forward and reverse primers selected are reported in the output file.
permits selection of primers that are complementary, without mismatch, to more than one site on the template sequence. By default, primers are selected that have single primer binding sites on the template sequence. (For more stringent control over primer binding on the template sequence, use -ALLANNEALTemplate and -ENDANNEALTemplate.)
specifies an input file of forward and reverse primer sequences from which to select appropriate oligonucleotide primers that bind to the template sequence and meet all primer and product constraints. If this parameter is used, parameters -PRIMERSF and -PRIMERSR cannot be used.
specifies an input file of forward primer sequences from which to select appropriate oligonucleotide primers that bind to the template sequence and meet all primer and product constraints. Reverse primers can also be given to the program through an input file (specified with the -PRIMERSR parameter) or they can be searched for in the template sequence. This parameter can not be used in combination with -PRImers.
specifies an input list of repeated sequences to check for false priming sites with putative primer sequences. You can specify any valid GCG sequence specification. Primers are rejected that are complementary, without mismatch, to any repeated sequence for a length equal to the minimum acceptable primer length. (For more stringent control over primer binding on repeated sequences, use -ALLANNEALTemplate and -ENDANNEALTemplate.)
specifies the nM concentration of primer DNA in the reaction. This value is used in the calculation of primer melting temperature. The default value is 50.0 and the value may range from 0.1 to 50.0.
specifies the mM salt concentration in the reaction. This value is used in the calculation of both primer and PCR product melting temperatures. The default value is 50.0 and the value may range from 0.1 to 50.0.
specifies the required 3'-terminal bases (3' clamp) for the primer. Any number of 3'-terminal bases can be specified, and all IUB nucleotide ambiguity symbols (described in Appendix III of the Program Manual) may be used. For example, -CLAmp=WSS requires all selected primers to end in the three-base sequence that has an A or T, followed by a G or C, then terminated by another G or C. By default, the program requires a G or C as the 3'-terminal base of all selected primers. Use -NOCLAmp to permit any 3'-terminal bases in selected primers.
sets the minimum acceptable % G+C for oligonucleotide primers. Use -NOGCMINPRImer to allow % G+C to be as low as 0.0%.
sets the maximum acceptable % G+C for oligonucleotide primers. Use -NOGCMAXPRImer to allow % G+C to be as high as 100.0%.
sets the minimum acceptable melting temperature (in degrees Celsius) for oligonucleotide primers. Use -NOTMMINPRImer to have no lower limit on the melting temperature set.
sets the maximum acceptable melting temperature (in degrees Celsius) for oligonucleotide primers. Use -NOTMMAXPRImer to have no upper limit on the melting temperature set.
sets the maximum acceptable 3'-terminal annealing score between two primers in tests of primer-primer complementarity. This score is used in tests of primer secondary structure and primer dimer formation. The default maximum acceptable 3'-terminal annealing score is 8.0. Set this to a higher value if you want to relax this constraint. Use -NOENDANNEALPrimer to have no upper limit on the primer-primer 3' annealing score set.
sets the relative contribution of the 3'-terminal annealing score between two primers in determining the output order of primers and PCR primer pairs.
sets the maximum acceptable annealing score over the entire lengths of two primers in tests of primer-primer complementarity. This score is used in tests of primer secondary structure and primer dimer formation. The default maximum acceptable annealing score over the entire lengths of two primers is 14.0. Set this to a higher value if you want to relax this constraint. Use -NOALLANNEALPrimer to have no upper limit on the primer-primer annealing score set.
sets the relative contribution of the annealing score over the entire lengths of two primers in determining the output order of primers and PCR primer pairs.
sets the minimum acceptable % G+C for amplified PCR products. Use -NOGCMINPROduct to allow % G+C to be as low as 0.0%.
sets the maximum acceptable % G+C for amplified PCR products. Use -NOGCMAXPROduct to allow % G+C to be as high as 100.0%.
sets the minimum acceptable melting temperature (in degrees Celsius) for amplified PCR products. Use -NOTMMINPROduct to have no lower limit on the melting temperature set.
sets the maximum acceptable melting temperature (in degrees Celsius) for amplified PCR products. Use -NOTMMAXPROduct to have no upper limit on the melting temperature set.
sets the maximum acceptable difference between the melting temperatures of the two primers in a PCR amplification experiment. Use -NOTMDIFference to allow any difference between the melting temperatures.
sets the maximum acceptable annealing score between the 3' end of the primer and possible false priming sites on the template sequence. Any repeated sequences you specify with -REPeats also are checked for false priming sites. By default, Prime does not determine the annealing score between the 3' end of the primer and possible false priming sites on the template and repeated sequences. If you specify -ENDANNEALTemplate without any value, then a value of 16.0 is used. Set this to a higher value if you want to relax this constraint.
sets the relative contribution of the annealing score between the 3' end of the primer and possible false priming sites on the template and repeated sequences in determining the output order of PCR primer pairs.
sets the maximum acceptable annealing score between the entire primer and possible false priming sites on the template sequence. Any repeated sequences you specify with -REPeats also are checked for false priming sites. By default, Prime does not determine the annealing score between the entire primer and possible false priming sites on the template and repeated sequences. If you specify -ALLANNEALTemplate without any value, then a value of 28.0 is used. Set this to a higher value if you want to relax this constraint.
sets the relative contribution of the annealing score between the entire primer sequence and possible false priming sites on the template and repeated sequences in determining the output order of PCR primer pairs.
as far as possible, removes
limits for most of the
constraints that are set by
default:
-MINPRImer, -MAXPRImer, -MINPROduct, -MAXPROduct, -CLAmp,
Note: Setting this option can
lead to output containing nonsense
results. So check your
output
carefully.
sorts the output list of
products by their annealing temperature
in increasing order, instead by
their annealing scores. The
list of products still contains
the products with the lowest
annealing
scores found.
creates a data file that
lists the primers that are
found. Each individual primer
or each primer
associated with one or more
PCR products is listed once,
along with its begin and
end ranges
with respect to the template
sequence. For example
forward1 1 TGGAGGCAGGACAAGTATGG ! 837 -> 856
means that the primer forward1 has the base sequence TGGAGGCAGGACAAGTATGG, which corresponds to bases 837 through 856 of the template sequence.
This file's format is the same as that used for the primer files specified with parameters -PRImers, -PRIMERSF and -PRIMERSR. These files can be used as input to a number of Wisconsin Package programs: Prime, PrimePair, MeltTemp, Map, MapSort, MapPlot, PeptideMap, PeptideSort and FindPatterns. See the INPUT FILES topic for more information on the format of this data file.
writes an RSF (rich sequence format) file containing the input sequences annotated with features generated from the results of Prime. This RSF file is suitable for input to other Wisconsin Package programs that support RSF files. In particular, you can use SeqLab to view this features annotation graphically. If you don't specify a file name with this parameter, then the program creates one using prime for the file basename and .rsf for the extension. For more information on RSF files, see "Using Rich Sequence Format (RSF) Files" in Chapter 2 of the User's Guide. Or, see "Rich Sequence Format (RSF) Files" in Appendix C of the SeqLab Guide.
sets the number of bases or amino acids per 100 platen units (PU). This is usually equivalent to the number of bases or amino acids per page. Output from different GCG graphics programs that are run at the same density can be compared by lining up the plots on a light box.
sets the spacing between each line of the display to 1.6 platen units. If the plot seems crowded on your plotter, try setting the spacing to 3.0.
suppresses the plot of primer site locations.
This program normally monitors its progress on your screen. However, when you use -Default to suppress all program interaction, you also suppress the monitor. You can turn it back on with this parameter. If you are running the program in batch, the monitor will appear in the log file.
writes a summary of the program's work to the screen when you've used -Default to suppress all program interaction. A summary typically displays at the end of a program run interactively. You can suppress the summary for a program run interactively with -NOSUMmary.
You can also use this parameter to cause a summary of the program's work to be written in the log file of a program run in batch.
submits the program to the batch queue for processing after prompting you for all required user inputs. Any information that would normally appear on the screen while the program is running is written into a log file. Whether that log file is deleted, printed, or saved to your current directory depends on how your system manager has set up the command that submits this program to the batch queue. All output files are written to your current directory, unless you direct the output to another directory when you specify the output file.
When Prime is run in batch using -BATch, instructions for plotting the primer sites are written to a figure file named prime.figure unless the plot has been directed to a specific file or graphics device from the command line, or has been suppressed with -NOPLOt.
The parameters below apply to all Wisconsin Package graphics programs. These and many others are described in detail in Chapter 5, Using Graphics of the User's Guide.
writes the plot as a text file of plotting instructions suitable for input to the Figure program instead of sending it to the device specified in your graphics configuration.
draws all text characters on the plot using Font 3 (see Appendix I).
draws the entire plot with the pen in stall 1.
The parameters below let you expand or reduce the plot (zoom), move it in either direction (pan), or rotate it 90 degrees (rotate).
expands the plot by 20 percent by resetting the scaling factor (normally 1.0) to 1.2 (zoom in). You can expand the axes independently with -XSCAle and -YSCAle. Numbers less than 1.0 contract the plot (zoom out).
moves the plot to the right by 30 platen units (pan right).
moves the plot up by 30 platen units (pan up).
rotates the plot 90 degrees. Usually, plots are displayed with the horizontal axis longer than the vertical (landscape). Note that plots are reduced or enlarged, depending on the platen size, to fill the page.
[ Program Manual | User's Guide | Data Files | Databases ]
Technical Support: support-us@accelrys.com
or support-eu@accelrys.com
Copyright (c) 1982-2002 Accelrys Inc. A subsidiary of Pharmacopeia, Inc. All rights reserved.
Licenses and Trademarks Wisconsin Package is a trademark and GCG and the GCG logo are registered trademarks of Accelrys Inc.
All other product names mentioned in this documentation may be trademarks, and if so, are trademarks or registered trademarks of their respective holders and are used in this documentation for identification purposes only.