PRIMEPAIR

[ Program Manual | User's Guide | Data Files | Databases ]

Table of Contents
FUNCTION
DESCRIPTION
EXAMPLE
OUTPUT
INPUT FILES
RELATED PROGRAMS
RESTRICTIONS
ALGORITHM
CONSIDERATIONS
SUGGESTIONS
COMMAND-LINE SUMMARY
LOCAL DATA FILES
PARAMETER REFERENCE

FUNCTION

[ Top | Next ]

PrimePair evaluates individual primers to determine their compatibility for use as PCR primer pairs. You can provide the primers in files (one for forward, one for reverse primers) or on the command line, or you can enter them interactively from the keyboard.

DESCRIPTION

[ Previous | Top | Next ]

PrimePair evaluates individual primers to determine their compatibility for use as PCR primer pairs. Unlike Prime, PrimePair is template independent and thus does not test the primers for suitability with a template sequence. Because there is no template sequence involved, the terms forward and reverse are used by this program only to differentiate one primer from its partner when it evaluates primer pairs.

In evaluating primer pairs, PrimePair relaxes most of the constraints on the primers to permissive settings. This is in contrast to Prime, which sets all constraints to more restrictive default values. You can mimic Prime's behavior by means of the -SETConstraints parameter, or you can set values for each of the constraints individually. Among the constraints that can be set are the primer melting temperature range and maximum allowable difference between primer melting temperatures, the range of percent G+C content and primer lengths, and the composition of a 3' clamp. Each forward primer is paired with each reverse primer and the pairs are listed in the output in order of their overall annealing scores.

For efficient priming, you should avoid primers with extensive self-complementarity in order to minimize the formation of primer secondary structure and primer dimers. Primer pairs with extensive complementarity between the two primers should be avoided in order to minimize primer dimer formation. PrimePair uses an annealing test described in the ALGORITHM topic to check individual primers for self-complementarity and to check primer pairs for complementarity to each other.

EXAMPLE

[ Previous | Top | Next ]

Here is a session using PrimePair to find compatible primer pairs among three forward primers and one reverse primer that are typed in interactively:


% primepair

 Enter forward primers individually, one per line.
 End the list with a blank line.

    Primer 1:  aaaagatgcaggcagaagg
    Primer 2:  attccagatgggggcaaag
    Primer 3:  catctatctggaggcaggac
    Primer 4:

 Enter reverse primers individually, one per line.
 End the list with a blank line.

    Primer 1:  acacacacacacacacac
    Primer 2:

 What should I call the output file name (* primepair.primepair *) ?

 Selecting forward primers
        .

 Selecting reverse primers
        .

 Selecting primer pairs
        .

 ////////////////////////////////////////////////////////////////

         Output file: primepair.primepair
            CPU time: 0.03 seconds

%

OUTPUT

[ Previous | Top | Next ]

Here is the output file listing the three primer pairs selected by PrimePair:


PRIMEPAIR of:
  forward list input from terminal and reverse list input from terminal
  January 8, 2002 10:36

                                 INPUT SUMMARY
                                 -------------

 Input forward primer list: from terminal with    3 primers.
 Input reverse primer list: from terminal with    1 primers.

 Primer constraints:
    primer size: 2 - 100
    primer 3' clamp: none specified
    primer sequence ambiguity: NOT ALLOWED
    primer GC content: 0.0 - 100.0%
    primer Tm: no limits
    primer self-annealing. . .
       3' end: < 8                    (weight:  2.0)
        total: < 14                   (weight:  1.0)

 Primer Pair constraints:
    difference in primer Tm: < 2.0 degrees Celsius
    primer-primer annealing. . .
       3' end: < 8                    (weight:  2.0)
        total: < 14                   (weight:  1.0)

                                           PRIMER SUMMARY
                                           --------------

                                     forward            reverse

 Number of primers considered:             3                  1

 Number of primers rejected for . . .
               primer 3' clamp:            0                  0
     primer sequence ambiguity:            0                  0
             primer GC content:            0                  0
                     primer Tm:            0                  0
         primer self-annealing:            0                  0

 Number of primers accepted:               3                  1

                                          PRIMERPAIR SUMMARY
                                          ------------------

 Number of pairs considered:                        3

 Number of pairs rejected for. . .
       difference in primer Tm:                     0
       primer-primer annealing:                     0

 Number of pairs accepted:                          3
    Number of pairs saved:                          3

--------------------------------------------------------------------------------

 Primer Pair: 1

 [DNA] = 50.000 nM   [salt] = 50.000 mM

                                          PRIMERS
                                          -------

                                        5'                3'
        forward primer (19-mer):        AAAAGATGCAGGCAGAAGG
        reverse primer (18-mer):        ACACACACACACACACAC

                                     forward            reverse

                    primer %GC:         47.4               50.0
   primer Tm (degrees Celsius):         50.0               50.1

            self annealing ...
                        3' end:           3                  0
                         total:          10                  0

                                   PRIMER PAIR
                                   -----------

       difference in primer Tm:  0.1 degrees Celsius

   primer-primer annealing ...
                        3' end:    3
                         total:    5

       overall annealing score:   27

--------------------------------------------------------------------------------

 Primer Pair: 2

 [DNA] = 50.000 nM   [salt] = 50.000 mM

                                          PRIMERS
                                          -------

                                        5'                3'
        forward primer (19-mer):        ATTCCAGATGGGGGCAAAG
        reverse primer (18-mer):        ACACACACACACACACAC

                                     forward            reverse

                    primer %GC:         52.6               50.0
   primer Tm (degrees Celsius):         51.5               50.1

            self annealing ...
                        3' end:           3                  0
                         total:          10                  0

                                   PRIMER PAIR
                                   -----------

       difference in primer Tm:  1.4 degrees Celsius

   primer-primer annealing ...
                        3' end:    3
                         total:    5

       overall annealing score:   27

--------------------------------------------------------------------------------

 Primer Pair: 3

 [DNA] = 50.000 nM   [salt] = 50.000 mM

                                          PRIMERS
                                          -------

                                        5'                 3'
        forward primer (20-mer):        CATCTATCTGGAGGCAGGAC
        reverse primer (18-mer):        ACACACACACACACACAC

                                     forward            reverse

                    primer %GC:         55.0               50.0
   primer Tm (degrees Celsius):         51.1               50.1

            self annealing ...
                        3' end:           3                  0
                         total:          12                  0

                                   PRIMER PAIR
                                   -----------

       difference in primer Tm:  1.0 degrees Celsius

   primer-primer annealing ...
                        3' end:    3
                         total:    5

       overall annealing score:   29

--------------------------------------------------------------------------------

The input summary lists all of the constraints used by the program to screen the primers and primer pairs. If few or no primer pairs are found, this section provides a starting point for adjusting parameters to relax the constraints.

The primer summary lists the number of forward and reverse primers considered by PrimePair, the number of primers rejected because they failed to meet all of the individual primer constraints, and the constraint(s) that caused them to be rejected. You can use this in conjunction with the input summary information to guide you in relaxing program constraints if few or no primer pairs are found.

The primer pair summary lists the number of primer pairs considered and the number of pairs rejected because they failed to meet the primer pair constraints. Again, you can use this information to relax the appropriate program constraints and increase the number of primer pairs that are accepted.

Lastly, the output contains the list of the primer pairs that passed all of the constraints imposed by PrimePair, ordered by their overall annealing scores.

INPUT FILES

[ Previous | Top | Next ]

In addition to accepting primer information interactively or from the command line, PrimePair can read primer data from files. You can specify separate files for forward and reverse primers, using the -PRIMERSF parameter for forward primers and the -PRIMERSR parameter for reverse primers.

The format of these files is very similar to the format of the enzyme data files used by the mapping programs, as described in Appendix VII. The primer names should not have more than 31 characters. The offset field is ignored by PrimePair, but the field must contain a number as a place holder for compatibility with the enzyme data file format. The primer sequences may contain any valid GCG sequence symbols (see Appendix III of this manual). Single quotation marks ( ' ) and underscores ( _ ) may also appear in the sequence, but are not used by the program. If a primer sequence contains any other characters, PrimePair ignores that primer and doesn't process it. The overhang field has no significance to PrimePair and can be omitted. (For other GCG mapping programs, if the overhang field is absent or is a non-numeric character, then the bottom strand is not searched.)

The exact spacing between each field does not matter, only the order of the fields in the line. Blank lines and lines that start with an exclamation point ( ! ) are ignored. Here is part of an example file of input primers:


An example file of input primers for the PrimePair program.

Name      Offset   Sequence                Documentation  ..

x13598         1   ACCCTTCAGCAGTTCCACAC    !
x24332         1   AAGCACCCTTCAGCAGTTCC    !
u35982         1   AAGAGAGGTGGAAATGAGG     !

RELATED PROGRAMS

[ Previous | Top | Next ]

Prime selects oligonucleotide primers for a template DNA sequence. The primers may be useful for the polymerase chain reaction (PCR) or for DNA sequencing. You can allow Prime to choose primers from the whole template or limit the choices to a particular set of primers listed in a file. MeltTemp computes the melting temperature of oligonucleotides. You can provide the oligonucleotide sequences in a file or simply type them in at the keyboard. The GCG mapping programs Map, MapPlot, and MapSort can be used to mark finds in the context of a DNA restriction map. FindPatterns identifies sequences that contain short patterns like GAATTC or YRYRYRYR. You can define the patterns ambiguously and allow mismatches. You can provide the patterns in a file or simply type them in from the terminal.

RESTRICTIONS

[ Previous | Top | Next ]

Primers longer than 100 bases or shorter than two bases are rejected.

ALGORITHM

[ Previous | Top | Next ]

Thermodynamic Calculations

PrimePair determines primer melting temperatures by a calculation using the nearest-neighbor model of Borer, and thermodynamic parameters for DNA nearest-neighbor interactions and the salt dependence of oligonucleotides determined by SantaLucia (Proc. Natl. Acad. Sci. USA. 95; 1460-1465 (1986)):

T(m)(primer) = delta H / ((delta S' + R x ln(c/4)) - 273.15

where delta H is the enthalpy of helix formation, delta S' is the salt-adjusted entropy of helix formation (including helix initiation), R is the molar gas constant (1.987 cal/degree Celsius/mol), and c is the primer concentration.

In the above equation, the salt-adjusted delta S' is determined from the delta S at 1M salt according to the equation:

delta S' = delta S + (0.368 x (primer_length - 1) x ln[K(+)])

where [K(+)] is the potassium ion concentration.

Annealing Tests

PrimePair uses an annealing test based on the one described by Hillier and Green (PCR Methods and Applications 1; 124-128 (1991)) to check individual primers for self-complementarity and to check the two primers in a PCR primer pair for complementarity to each other. For tests of self-complementarity, a primer sequence in the 5' to 3' orientation is compared with the same sequence in the 3' to 5' orientation. For tests of complementarity between two different primers, one of the primer sequences in the 5' to 3' orientation is compared to the other sequence in the 3' to 5' orientation.

The sequences are compared in every register of comparison, using a scoring matrix to assign values to each base pair comparison. (See the LOCAL DATA FILES topic for more information on the scoring matrix.) The scores of contiguous base pairs with positive comparison values are summed for each register of comparison. The maximum score of all such contiguous segments, taken over all registers of comparison, is the total annealing score. Complementarity at the 3' ends of primer sequences has a particularly large influence on primer-dimer formation. Therefore the maximum score of all contiguous segments that include the 3' position of either primer sequence, taken over all registers of comparison, is separately determined and reported as the 3' end annealing score .

The total and 3' annealing scores are saved separately for primer self-complementarity tests and for tests of complementarity between the two primers in PCR primer pairs. Primers that exceed the maximum score specified for any of these tests are rejected. For primer pairs that are accepted, the program determines an overall annealing score for each pair to use in determining their order in the output. The overall score is the sum of all annealing scores associated with the two primers. You can specify weights for each of these scores to adjust their relative contributions to the overall score. By default, 3' annealing scores have twice the weight of total annealing scores.

CONSIDERATIONS

[ Previous | Top | Next ]

PrimePair does not accept ambiguous bases, since the thermodynamics for these cases are not completely understood. Primers containing ambiguous bases are rejected.

PrimePair only determines melting temperatures for DNA primers. We do not know of any appropriate nearest-neighbor thermodynamic parameters for RNA-DNA hybrids, so we haven't attempted to calculate melting temperatures for RNA primers. While thermodynamic parameters for RNA duplexes involving mismatches have been described, we do not know of any similar results for DNA duplexes. Therefore, we have not attempted to calculate melting temperatures or other thermodynamic properties for DNA duplexes involving mismatches.

PrimePair does not currently consider formamide concentration in determining primer melting temperatures.

SUGGESTIONS

[ Previous | Top | Next ]

If PrimePair fails to select any appropriate primer pairs, review the primer and primer pair summaries to determine which constraints caused the primers to be rejected. With this information, you can determine which constraints to relax in subsequent runs of the PrimePair program.

COMMAND-LINE SUMMARY

[ Previous | Top | Next ]

All parameters for this program may be added to the command line. Use -CHEck to view the summary below and to specify parameters before the program executes. In the summary below, the capitalized letters in the parameter names are the letters that you must type in order to use the parameter. Square brackets ([ and ]) enclose parameter values that are optional. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.


Minimal Syntax: % primepair -OLIGOSF=AAAAGATGCAGGCAGAAGG
                            -OLIGOSR=ACACACACACACACACAC -Default

Prompted Parameters:

[-OUTfile1=]primepair.primepair  names the output file
-OLIGOSF=AAAAGATGCAGGCAGAAGG     specifies a forward primer
-OLIGOSR=ACACACACACACACACAC      specifies a reverse primer

Local Data Files:

-DATa1=prime.cmp     assigns scoring matrix for annealing tests
-DATa2=dnastack.dh   assigns enthalpies for DNA melting temperature
                       determination
-DATa3=dnastack.ds   assigns entropies for DNA melting temperature
                       determination

Optional Parameters:

-PRIMERSF=forward.dat    assigns forward primers from a file
-PRIMERSR=reverse.dat    assigns reverse primers from a file
-LIStsize=25             sets the maximum number of output primers pairs
                           shown
-DNAconcentration=50.0   sets the primer DNA concentration (nM)
-SALtconcentration=50.0  sets the salt concentration (mM)
-CLAmp=s                 specifies primer 3' clamp (using IUB ambiguity
                           codes)
-MINPRImer=18            sets the minimum primer length
-MAXPRImer=22            sets the maximum primer length
-GCMINPRImer=40.0        sets the minimum primer % G+C
-GCMAXPRImer=55.0        sets the maximum primer % G+C
-TMMINPRImer=50.0        sets the minimum primer melting temperature
                           (Celsius)
-TMMAXPRImer=65.0        sets the maximum primer melting temperature
                           (Celsius)
-ENDANNEALPrimer=8.0     sets the maximum primer-primer 3' annealing score
  -ENDWGTPrimer=2.0        sets the relative weight of primer-primer 3'
                             annealing score
-ALLANNEALPrimer=14.0    sets the maximum primer-primer annealing score
  -ALLWGTPrimer=1.0        sets the relative weight of primer-primer
                             annealing score
-TMDIFference=2.0        sets the maximum difference between melting
                           temperature of two primers in PCR
-SETConstraints          sets relaxed constraints (options -CLAmp through
                           -TMMAXPRImer) to their default values
  -IGNore=clamp, ...       ignores the constraints listed.  The following
                             constraints can be ignored: clamp, minprimer,
                             maxprimer, gcminprimer, gcmaxprimer, tmminprimer,
                             tmmaxprimer.
-FOUndprimers            creates a pattern data file of found primers

-NOMONitor               suppresses screen trace of program progress
-NOSUMmary               suppresses screen summary at the end of the
                           program
-BATch                   submits program to the batch queue

LOCAL DATA FILES

[ Previous | Top | Next ]

The files described below supply auxiliary data to this program. The program automatically reads them from a public data directory unless you either 1) have a data file with exactly the same name in your current working directory; or 2) name a file on the command line with an expression like -DATa1=myfile.dat. For more information see Chapter 4, Using Data Files in the User's Guide.

PrimePair reads a scoring matrix from your local directory or the public database to use in the annealing tests that test for primer secondary structure and primer dimer formation. The file prime.cmp assigns G-C, A-T, and G-T base pairs values of 3, 2, and 1, respectively, with all other pairs valued at 0.

PrimePair reads the files dnastack.ds and dnastack.dh to obtain the DNA stacking entropies and enthalpies, respectively, used to calculate oligonucleotide primer melting temperatures.

PARAMETER REFERENCE

[ Previous | Top | Next ]

You can set the parameters listed below from the command line. For more information, see "Using Program Parameters" in Chapter 3, Using Programs in the User's Guide.

-OLIGOSF=AAAAGATGCAGGCAGAAGG

specifies a forward primer.

-OLIGOSR=ACACACACACACACACAC

specifies a reverse primer.

-PRIMERSF=forward.dat

specifies a file containing one or more forward primers.

-PRIMERSR=reverse.dat

specifies a file containing one or more reverse primers.

-MINPRImer=18

sets the minimum primer length.

-MAXPRImer=22

sets the maximum primer length.

-LIStsize=25

sets the maximum number of primer pairs you want to save in the output file. By default, 25 primer pairs are saved.

-DNAconcentration=50.0

specifies the nM concentration of primer DNA in the reaction. This value is used in the calculation of primer melting temperature. The default value is 50.0 and the value may range from 0.1 to 50.0.

-SALtconcentration=50.0

specifies the mM salt concentration in the reaction. This value is used in the calculation of both primer and PCR product melting temperatures. The default value is 50.0 and the value may range from 0.1 to 50.0.

-CLAmp=S

specifies the required 3'-terminal bases (3' clamp) for the primer. Any number of 3'-terminal bases can be specified, and any IUB nucleotide ambiguity symbols (described in Appendix III of the Program Manual) may be used. For example, -CLAmp=WSS requires all selected primers to end in the three-base sequence that has an A or T, followed by a G or C, then terminated by another G or C. By default, the program requires a G or C as the 3'-terminal base of all selected primers. Use -NOCLAmp to permit any 3'-terminal bases in selected primers.

-GCMINPRImer=40.0

sets the minimum acceptable percent G+C for oligonucleotide primers.

-GCMAXPRImer=55.0

sets the maximum acceptable percent G+C for oligonucleotide primers.

-TMMINPRImer=50.0

sets the minimum acceptable melting temperature (in degrees Celsius) for oligonucleotide primers.

-TMMAXPRImer=65.0

sets the maximum acceptable melting temperature (in degrees Celsius) for oligonucleotide primers.

-ENDANNEALPrimer=8.0

sets the maximum acceptable 3'-terminal annealing score between two primers in tests of primer-primer complementarity. This score is used in tests of primer secondary structure and primer dimer formation. The default maximum acceptable 3'-terminal annealing score is 8.0. Set this to a higher value if you want to relax this constraint

-ENDWGTPrimer=2.0

sets the relative contribution of the 3'-terminal annealing score between two primers in determining the output order of primers and PCR primer pairs.

-ALLANNEALPrimer=14.0

sets the maximum acceptable annealing score over the entire lengths of two primers in tests of primer-primer complementarity. This score is used in tests of primer secondary structure and primer dimer formation. The default maximum acceptable annealing score over the entire lengths of two primers is 14.0. Set this to a higher value if you want to relax this constraint.

-ALLWGTPrimer=1.0

sets the relative contribution of the annealing score over the entire lengths of two primers in determining the output order of primers and PCR primer pairs.

-TMDIFference=2.0

sets the maximum acceptable difference between the melting temperatures of the two primers in a PCR amplification experiment.

-SETConstraints

sets the relaxed constraints to their default values. This is equivalent to putting all of the following on the command line: -CLAmp=s, -MINPRImer=18, -MAXPRImer=22, -GCMINPRImer=40.0, -GCMAXPRImer=55.0, -TMMINPRImer=50.0, -TMMAXPRImer=65.0.

-IGNore=CLAmp, ...

ignores the constraints specified. Any constraint that is set by -SETConstraints can be ignored by means of this parameter.

-FOUndprimers

creates a data file of the accepted primers that is in the same format as the primer files specified with parameters -PRIMERSF and -PRIMERSR. This output file can be used as input to a number of Wisconsin Package programs: Prime, PrimePair, MeltTemp, Map, MapSort, MapPlot, PeptideMap, PeptideSort and FindPatterns. See the INPUT FILES topic for more information on the format of this data file.

-MONitor

This program normally monitors its progress on your screen. However, when you use -Default to suppress all program interaction, you also suppress the monitor. You can turn it back on with this parameter. If you are running the program in batch, the monitor will appear in the log file.

-SUMmary

writes a summary of the program's work to the screen when you've used -Default to suppress all program interaction. A summary typically displays at the end of a program run interactively. You can suppress the summary for a program run interactively with -NOSUMmary.

You can also use this parameter to cause a summary of the program's work to be written in the log file of a program run in batch.

-BATch

submits the program to the batch queue for processing after prompting you for all required user inputs. Any information that would normally appear on the screen while the program is running is written into a log file. Whether that log file is deleted, printed, or saved to your current directory depends on how your system manager has set up the command that submits this program to the batch queue. All output files are written to your current directory, unless you direct the output to another directory when you specify the output file.

Printed: January 9, 2002 13:45 (1162)

[ Program Manual | User's Guide | Data Files | Databases ]


Technical Support: support-us@accelrys.com
or support-eu@accelrys.com

Copyright (c) 1982-2002 Accelrys Inc. A subsidiary of Pharmacopeia, Inc. All rights reserved.

Licenses and Trademarks Wisconsin Package is a trademark and GCG and the GCG logo are registered trademarks of Accelrys Inc.

All other product names mentioned in this documentation may be trademarks, and if so, are trademarks or registered trademarks of their respective holders and are used in this documentation for identification purposes only.

Accelrys Inc.

www.accelrys.com/bio